More Fields
Strain Species Genotype
ABR212 C. elegans acd-1(sta6) delm-2(ok1822) I. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4).
ABR225 C. elegans acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.
CA998 C. elegans ieDf2 [unc-119+]/mIs11 IV. Show Description
mIs11 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP]. Heterozygotes are wild-type with dim GFP signal in the pharynx. mIs11 homozygotes are wild-type with bright GFP in the pharynx. ieDf2 homozygotes (non-GFP) develop normally but produce 97.5% inviable embryos and a high frequency of males among the surviving self-progeny. Pick WT with dim GFP+ in pharynx to maintain. mIs11 homozygotes will quickly overtake the population if not selected against. GFP expression in 4-cell embryos, pharyngeal muscle and gut. ieDf2 is a deficiency of zim-1, zim-2, zim-3, and him-8 generated by MosDel, resulting in single-copy insertion of a copy of the C. briggsae unc-119 gene on Chromosome IV. The deletion spans the sequences from the beginning of the zim-1 coding sequence through the ttTi22866 Mos1 insertion site.
CER348 C. elegans trxr-1(cer35[Sec666C]) IV. Show Description
Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).
CER374 C. elegans trxr-1(cer55[Sec666X]) IV. Show Description
Missense mutation engineered by CRISPR removes a selenocysteine to place a stop codon. Resistance to cisplatin exposure. Primers to genotype the cer55 and other silent mutations: [Common Fw: #1224 GGCTTCCACATTCTCACTCC] [RV wildtype: #1414 cTTAACCTCAGCAACCAGAA] [RV Sec to STOP: #1421 CTTAACCTTAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).
DCL569 C. elegans mkcSi13 II; rde-1(mkc36) V. Show Description
mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II. Germline rescue of the rde-1(mkc36) indel mutation, allowing germline-specific RNAi. Reference: Zou L, et al. Scientific Reports Volume 9, Article number: 2354 (2019) "Construction of a germline-specific RNAi tool in C. elegans."
EG4348 C. elegans Show Description
Utah natural isolate carrying peel-1(qq99) I. EG4348 was collected by M. Ailion from Salt Lake City, UT. qq99 designates the naturally occurring nonsense mutation in peel-1. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115.
EG5389 C. elegans oxIs494 II; unc-119(ed3) III. Show Description
oxIs494 [peel-1p::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. GFP is expressed in the spermatogenic germline. During spermatogenesis, GFP remains in the residual body and is not packaged into sperm. Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
EG5767 C. elegans qqIr7 I; oxSi78 II; unc-119(ed3) III. Show Description
qqIr7 [peel-1(qq99)] I. oxSi78 [peel-1p::peel-1 (introns included)::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. Genetic background is a mixture of N2 and wild isolate EG4348. The oxSi78 insertion produces a PEEL-1::GFP translational fusion. PEEL-1::GFP is expressed in the spermatogenic germline and packaged into sperm. PEEL-1::GFP appears to localize to fibrous body-membranous organelles. PEEL-1::GFP does not rescue peel-1(qq99). Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
EG5801 C. elegans oxSi87 II; unc-119(ed3) III. Show Description
oxSi87 [peel-1p::N-terminal 12 amino acids of PEEL-1::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. GFP is expressed in the spermatogenic germline. During spermatogenesis, GFP is packaged into sperm. Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.
EGD329 C.elegans egxSi126 I; unc-119(ed3) III Show Description
egxSi126 [mex-5p::hsp-3(aa1-19)::halotag::HDEL::pie-1 3’UTR + unc-119(+)] I. Superficially wild-type. Stable expression of Halotag in the ER lumen in the germline and embryos. Reference: Fan X, et al. G3 (accepted).
EGD565 C.elegans egxSi145 II; unc-119(ed3) III. Show Description
egxSi145 [mex-5p::hsp-3(aa1-19)::halotag::HDEL::pie-1 3’UTR + unc-119(+)] II. Superficially wild-type. Stable expression of Halotag in the ER lumen in the germline and embryos. Reference: Fan X, et al. G3 (accepted).
GR1428 C. elegans mgIs45 I. Show Description
mgIs45 [mir-84(+) + tub-1::GFP] I. mir-84 over-expressing line. Reference: Hayes GD, Riedel CG, Ruvkun G. Genes Dev. 2011 Oct 1;25(19):2079-92.
GR1452 C. elegans veIs13 V; let-7(mn112) unc-3(e151) X; mgEx725. Show Description
veIs13 [col-19::GFP + rol-6(su1006)] V. mgEx725 [lin-4::let-7 + ttx-3::RFP]. Pick RFP+ to maintain. mgEx725 rescues lethality of let-7(mn112). Precocious expression of col-19::GFP at the L4 stage. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
GR1583 C. elegans somi-1(mg415) V. Show Description
Adults slightly Dpy. Suppresses defects caused by over-expression of mir-84. Enhances retarded heterchronic phenotypes caused by a weak allele of let-7 or loss of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
GR1586 C. elegans somi-1(tm562) V. Show Description
Adults slightly Dpy. Suppresses defects caused by over-expression of mir-84. Enhances retarded heterchronic phenotypes caused by a weak allele of let-7 or loss of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
GR1589 C. elegans mgIs45 I; somi-1(mg431) wIs54 V. Show Description
mgIs45 [mir-84(over-expressing) + tub-1::GFP] I. wIs54 [scm::GFP] V. Maintain by picking animals with good expression of tub-1::GFP in amphid neurons to maintain. somi-1 mutation suppresses precocious development of the vulva and hypodermal cells caused by over-expression of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
GR1895 C. elegans daf-2(e1370) III; mgIs67. Show Description
mgIs67 [daf-16p::daf-16::GFP + rol-6(su1006)]. Temperature-sensitive. Daf-c. Maintain at 15C. Dauer formation at 25C. Slow growing. Dauer-like at 20C. DAF-16::GFP is fully nuclear at 20C. Reference: Riedel CG, et al. Nat Cell Biol. 2013 May;15(5):491-501.
HA1706 C. elegans pha-1(e2123) III; rtEx726. Show Description
rtEx726 [del-1p::YC2.60 + pha-1(+)] expresses yellow cameleon YC2.60 in a subset of motor neurons. Maintain at 25C to select for the presence of the array. Haspel G, et al. (2010) J. Neurosci. 30:11151-6.
HA2464 C.elegans sod-1(tm776) II; rtSi8 IV; him-5 V; vsIs48. Show Description
rtSi8 [sod-1p::sod-1(A4V) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. vsIs48 [unc-17::GFP]. A4V mutation in C. elegans sod-1 genomic rescue construct mimics human SOD1 disease model. Superficially wild-type with increased sensitivity to paraquat in multiple assays. GFP expressed in all cholinergic neurons. Strain reportedly carries a him-5 mutation in the background, though specific allele has not been confirmed. HA2619 serves as a control strain for HA2464. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.
HA2846 C.elegans fust-1(rt256[R446S]) II. Show Description
fust-1(rt256[R446S]) was created by CRISPR editing of arginine codon in C. elegans fust-1 to create FUS disease model for human mutation R524S. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2846 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi:
HA2847 C.elegans fust-1(rt257[P447L]) II. Show Description
fust-1(rt257[P447L]) was created by CRISPR editing of proline codon in C. elegans fust-1 to create FUS disease model for human mutation P525L. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2847 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi:
HA2987 C. elegans sod-1(rt449[G85RC]) II. Show Description
sod-1(rt449[G85RC]) was created by CRISPR editing of the cognate glycine codon in C. elegans sod-1 to create a disease model for human mutation G93A. This strain also contains additional silent edits, and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2987 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi:
HA3299 C. elegans sod-1(rt451[sod-1G85R]) II. Show Description
Superficially wild-type with increased sensitivity to paraquat in multiple assays. Can be maintained 15-25C. rt451 is CRISPR/Cas9 engineered G85R missense mutation in endogenous sod-1 locus mimicking human ALS SOD1 model. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.
IMN26 C. elegans dapk-1(gk219) I; glt-3(bz34) IV; nuIs5 V. Show Description
nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. dapk-1(gk219) decreases neurodegeneration. Reference: Del Rosario J, et al. BMC Neurosci. 2015 Apr 23;16:25.
IMN27 C. elegans dapk-1(gk219) I; glt-3(bz34) IV. Show Description
Reference: Del Rosario J, et al. BMC Neurosci. 2015 Apr 23;16:25.
IMN28 C. elegans dapk-1(gk219) I; nuIs5 V. Show Description
nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Del Rosario J, et al. BMC Neurosci. 2015 Apr 23;16:25.
IMN30 C. elegans pinn-1(tm2235) II; glt-3(bz34) IV; nuIs5 V. Show Description
nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. pinn-1(tm2235) increases neurodegeneration. Reference: Del Rosario J, et al. BMC Neurosci. 2015 Apr 23;16:25.
JH3479 C. elegans meg-3(ax3056[del(1-544)::OLLAS]) meg-4(ax3052) X. Show Description
Embryonic P granules not localized, 30% maternal effect sterility on average, insensitivity to RNAi. meg-3(ax3056) is an-frame deletion in the endogenous meg-3 locus removing the first 544 amino acids (1-544); MEG-3 forms a cytoplasmic gradient but does not form granules in the early embryos or recruit other P granule components such as PGL-1/3. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
JH3553 C. elegans meg-3(ax4503[del(545-862)::OLLAS]) meg-4(ax4504) X. Show Description
20% maternal effect sterility on average, RNAi insensitivity, MEG-3 does not form cytoplasmic gradient. meg-3(ax4503) is an-frame deletion in the endogenous meg-3 locus removing amino acids 545-862; MEG-3 does not form a cytoplasmic gradient but does still form granules in the early embryos and co-localizes with PGL-3 . References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
JK6403 C. elegans mpk-1(q1147[V5::mpk-1B] q1201[mpk-1B del] q1183[mpk-1AB::2xOLLAS])/qC1 [qIs56] III. Show Description
qIs56 [lag-2p::GFP + unc-119(+)]. q1201 is a 125 bp deletion causing a frameshift in mpk-1B without affected mpk-1A. Heterozygous animals Roll and have GFP+ distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes (sterile, but form a vulva). qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
JRB1 Halicephalobus mephisto Halicephalobus mephisto wild isolate. Show Description
Halicephalobus mephisto wild isolate. Has approximately 1.15% snp heterozygosity. Parthenogenetic reproduction so it cannot be out-crossed. Can survive higher temperatures than C. elegans. Useful model organism for studying heat tolerance; has expanded Hsp70 and AIG1 gene families. References: Borgonie G, et al. Nature. 2011 Jun 2;474(7349):79-82. Weinstein DJ, et al. Nat Commun. 2019 Nov 21;10(1):5268.
JVR406 C.elegans jerEx30. Show Description
jerEx30 [ddr-2p::BiFC1 (EGFH1-LINK-SYN) + tph-1p::BIFC2 (SYN-EGFH2) + rol-6(su1006)]. Pick Rollers to maintain. a-Synuclein BiFC transfer strain is a model to investigate neuron-to-neuron ?-syn transfer. Reference: Tyson T, et al. Sci Rep. 2017 Aug 8;7(1):7506.
KRA439 C. elegans unc-3(n3435) X; kasEx149. Show Description
kasEx149 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 200bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is been abolished; expression was observed specifically in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
KRA441 C. elegans unc-3(n3435) X; kasEx151. Show Description
kasEx151 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 300bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is retained, but eliminates ectopic expression in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
MAD63 C. elegans dqSi1 II; unc-119(ed3) III. Show Description
dqSi1 [mex-5p::atx-2a(cDNA)::GFP::tbb-2 3’UTR + unc-119(+)] II. Made by injection into strain EG6699; insertion confirmed by sequencing. dqSi1 rescues atx-2(ne4297). Reference: Gnazzo MM, et al. Mol Biol Cell. 2016 Oct 15;27(20):3052-3064. (PMID: 27559134) Del Castillo U, et al. Traffic. 2019 Jun;20(6):436-447. (PMID: 30989774)
NC138 C. elegans dpy-20(e1282) IV; wdIs3 X. Show Description
wdIs3[del-1::GFP + dpy-20(+)]. del-1 is expressed in the VB motor neurons beginning the the L2 larval stage. By the end of L2, del-1::GFP is also visible in a few VA motor neurons at the anterior end of the nerve cord. Expression of del-1::GFP in the VAs progresses in a wave from anterior to posterior, with all VAs expressing del-1::GFP by the adult stage. Thus, del-1::GFP is not expressed in the VAs during the L2 period in which unc-4 functions in those cells to establish synaptic inputs but is expressed in the VAs after they have been wired into the ventral cord circuit. del-1::GFP is also expressed in five neurons (VB1, VB2, SABVR, SABVL, VA1) in the retrovesicular ganglion at the anterior end of the ventral nerve cord. During the mid-L2 larval stage, del-1::GFP expression in the ventral nerve cord is largely restricted to the VB class of motor neurons.
NC190 C. elegans wdIs6 II; dpy-20(e1282) IV. Show Description
wdIs6 [del-1::GFP + dpy-20(+)]. Embryonic GFP expression in SABVR, SABVL, VBs in mid-L2, VAs in mid-L3.
NC279 C. elegans del-1(ok150) X. Show Description
2 kb deletion mutant made by OMRF Knockout Group. Presumptive null. No obvious phenotype. Primers used: EL1: GAAACGGTGAGTGCCAATTT. ER1: AGTGCTGTCACACCAAGCAC. IL1: AAACCAACTGACCCAAGGTG. IR1: TATCTAGGGTCCGCACAACC. Left breakpoint sequence: AGGTTGACAAATTGTTGCGA. Right breakpoint sequence: CGCTTATTAAAAAATAATAT.
OG472 C. elegans drSi2 II; unc-119(ed3) III. Show Description
drSi2 [vha-6p::3XFLAG::pgp-3/CFTR(wt)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with enrichment at the apical membrane. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR (TIKENIIFG). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.
OG474 C. elegans drSi4 II; unc-119(ed3) III. Show Description
drSi4 [vha-6p::3XFLAG::pgp-3/CFTR(delta F508)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with significantly diminished expression as compared to drSi2. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR with F508 deleted (TIKENII_G). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.
OH10051 C. elegans unc-119(ed3) III; sox-2(ot640[unc-119(+)])/+ X. Show Description
ot640 was generated by using MosDel removing the entire sox-2 locus and insert unc-119(+). Heterozygotes are WT and segregate WT heterozygotes, Uncs and ot640 homozygous that arrest in L1 with a pharynx unattached (Pun) phenotype. Maintain by picking WT and check for correct segregation of progeny to maintain. Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77.
OH10053 C. elegans unc-119(ed3) III; sox-2(ot640[unc-119(+)]) X; otEx4454. Show Description
otEx4454 [sox-2(fosmid)::mCherry + elt-2p::DsRed]. ot640 was generated by using MosDel removing the entire sox-2 locus and insert unc-119(+). ot640 homozygous arrest in L1 with a pharynx unattached (Pun) phenotype. Maintain by picking WT to maintain (transgene should be required for viability). Reference: Vidal B, et al. Development. 2015 Jul 15;142(14):2464-77.
OH10712 C. elegans pha-1(e2123) III; otEx4794. Show Description
otEx4794 [del-1p(2.6kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10754 C. elegans pha-1(e2123) III; otEx4818. Show Description
otEx4818 [del-1p(2.6kb promoter)::DsRed2 + pha-1(+)]. Maintain at 25C. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH3313 C. elegans oyIs14 V; otIs37 X. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otIs37 [unc-47(del)::GFP]. GFP fluorescence in PVT and DBV.
OH3314 C. elegans oyIs14 V; otIs38 X. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otIs38 [unc-47(del)::GFP]. otIs38 is integrated juEx60 [(pCZ114) unc-47(del)::GFP]. GFP fluorescence in PVT and DBV.
OP50-GFP Escherichia coli E. coli. Show Description
Bacteria. A strain of OP50 that contains a GFP plasmid (pFPV25.1) that is very fluorescent. Resistant to ampicillin. Originally published in Caenorhabditis elegans is a model host for Salmonella typhimurium. Labrousse A, Chauvet S, Couillault C, Kurz C, Ewbank J. Curr Biol. 2000 Nov 30;10(23):1543-5.
QX1409 C. elegans qqIR7 (I: peel-1(qq99), EG4348>N2); ttTi5605 II; unc-119(ed3) III. Show Description
Nonsense allele of peel-1 carried in Utah isolate EG4348 crossed into N2 Bristol background. Reference: Seidel HS et al. PLoS Biol. 2011 Jul;9(7):e1001115.
RB1979 C. elegans del-3(ok2613) I. Show Description
F26A3.6. Homozygous. Outer Left Sequence: TCATCGCTTCTACGTGCATC. Outer Right Sequence: ATAATTGGAAGGGTTTCCCG. Inner Left Sequence: TAGCCCCCTACACCTCACAG. Inner Right Sequence: TAAATCGGCACCTGCTTTC. Inner Primer PCR Length: 1222 bp. Deletion Size: 350 bp. Deletion left flank: TATATAAATAAGACACAACTGGCGTCGATT. Deletion right flank: ATAATCAGCTGCTTCACGAAGCGATGGATT. Insertion Sequence: TCGTGAAAGCAGCTGATTACGAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807