Species Information: C.elegans

Name C.elegans
NCBI Taxonomy ID

C.elegans strains available at the CGC

Strain Genotype Description
VB1605 svIs69. svIs69 [daf-28p::daf-28::GFP + unc-4(+)]. Derived from injection of pVB298gk (daf-28p::daf-28::GFP) with unc-4(+) into unc-4(e120). unc-4(e120) was likely removed during out-crossing, but might still be in background.
MLC657 akap-1(luc37) III. luc37 removes mir-791 binding sites in the akap-1 3'UTR. luc37 worms show less response towards a gradual increase in CO2 concentration from 0-5% as compared to N2 animals, similar to the response of mir-791(lf) animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
MLC613 unc-9(luc30) X. luc30 removes mir-791/mir-790 binding sites in the unc-9 3'UTR. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
MLC356 lucEx247. lucEx247 [gcy-9(fosmid)::GFP + ttx-3p::mCherry]. Pick mCherry+ to maintain. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.
CGC59 gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CB7248 dpy-18(e499)/subs-4(e3026) III; wIs78 IV. wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. Heterozygous strain. Wild-type hermaphrodites segregating wild-type, Dpy-18, and dead eggs (subs-4 homozygotes). Pick wild-type to maintain. Reference: Gravato-Nobre et al (in preparation).
ML2482 noah-1(mc68[noah-1::mCherry]) I. Superficially wild-type. Endogenous noah-1 locus tagged with mCherry. Reference: Vuong-Brender TTK, et al. Development. 2017 May 19. pii: dev.150383.
ML2615 dlg-1(mc103[dlg-1::gfp]) X. Superficially wild-type. Endogenous dlg-1 locus tagged with GFP.
ML2540 nmy-1(mc82[nmy-1::gfp]) X. Superficially wild-type. Endogenous nmy-1 locus tagged with GFP. Reference: Vuong-Brender TTK, et al. eLife 2017;6:e23866 DOI: 10.7554/eLife.23866.
ML2550 git-1(mc86[git-1::histag::2xpreCissionCleavageSite::gfp) X. Superficially wild-type. Reference: Vuong-Brender TTK, et al. Development 2017 : doi: 10.1242/dev.150383
CGC62 umnIs48 V. umnIs48 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.
GRU101 gnaIs1. gnaIs1 [myo-2p::yfp]. Control strain for pan-neuronal amyloid beta1-42 expressing strain GRU102. WT phenotype with pharyngeal YFP expression. Reference: Fong S, et al. Sci Rep. 2016 Sep 22;6:33781. doi: 10.1038/srep33781.
GRU102 gnaIs2. gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42]. Pan-neuronal amyloid beta1-42 expression. Impaired neuromuscular and sensorimotor behavior. See GRU101 for wild-type control strain. Reference: Fong S, et al. Sci Rep. 2016 Sep 22;6:33781. doi: 10.1038/srep33781.
CGC70 eT1 III; eT1 [umnIs56] V. umnIs56 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
MLC749 lucSi61 II; henn-1(tm4477) III. lucSi61 [ASEp::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
CGC84 umnIs65 V. umnIs65 [myo-2p::mKate2 + NeoR, V:4308261 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9.
OH13185 otIs591. otIs591 [unc-3(fosmid)::GFP + lin-44::YFP]. GFP reporter is expressed in all unc-3-expressing neurons. Reference: Kratsios P, et al. Curr Biol. 2015 May 18;25(10):1282-95.
CGC92 dpy-5(e61)/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
EEG107 tph-1(mg280) II; mudIs1. mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. When tph-1 mutants carrying mudIs1 are exposed to blue light, the worms continue to move rather than stopping like wild-type animals. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
XE1890 aex-6(sa24) I; wpEx287. wpEx287 [unc-47p::aex-6::unc-54 3'UTR + myo-2p::mCherry]. Pick mCherry+ to maintain. aex-6 a.k.a. rab-27. Reference: Sekine Y, et al. Cell reports. 2018; 23(2):415-428.
XE1347 wpIs39 X. wpIs39 [unc-47p:mCherry] X. mCherry expression in GABA neurons. Reference: Byrne AB, et al. Elife. 2016 Oct 4;5. pii: e12734.
OH14935 otIs648. otIs648 [hlh-3(fosmid)::GFP + ttx-3p::mCherry]. Transgene is expressed in HSN neurons. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979.
OH12412 otIs502. otIs502 [hlh-2(fosmid)::YFP + myo-3p::mCherry]. Broad embryonic expression; later in development transgene is expressed in DTCs, vulva, and some gland cells in pharynx. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979.
HA2823 smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.
SOZ300 cyp-37A1(ssd9) II. ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. cyp-37A1 previously known as drop-1.
OH14884 pha-1(e2123) III; him-5(e1490) V; otIs646. otIs646 [srh-127p::GFP + pha-1(+)]. Robust GFP expression in ADL neurons. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979.
OH11157 pha-1(e2123) III; otIs393. otIs393 [ift-20p::NLS::tagRFP + pha-1(+)]. Maintain at 25C to retain array. Pan-sensory neuronal GFP expression. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979.
JCP341 jcpSi10 II; unc-119(ed3) III. jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
WBM1144 wbmIs68 IV. wbmIs68 [rab-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs66] (IV:5015000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs68 exhibits neuron-specific wrmScarlet expression driven the rab-3 promoter. Derived from parental strain WBM1141 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific rab-3 promoter inserted as a single copy into the C. elegans genome (wbmIs66). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
YL140 meg-1(vr11) X. Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: CAGTTCCAAATGAATCAAAG / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
RG3056 B0464.6(ve556[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Homozygous viable. Deletion of 2168 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: GTTTCACAAAATGAATAAATTGAGCGATAG ; Right flanking sequence: TGATGCCTGTGATGTGTTGAGTAATGAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
EGD329 egxSi126 I; unc-119(ed3) III egxSi126 [mex-5p::hsp-3(aa1-19)::halotag::HDEL::pie-1 3’UTR + unc-119(+)] I. Superficially wild-type. Stable expression of Halotag in the ER lumen in the germline and embryos. Reference: Fan X, et al. G3 (accepted).
EGD565 egxSi145 II; unc-119(ed3) III. egxSi145 [mex-5p::hsp-3(aa1-19)::halotag::HDEL::pie-1 3’UTR + unc-119(+)] II. Superficially wild-type. Stable expression of Halotag in the ER lumen in the germline and embryos. Reference: Fan X, et al. G3 (accepted).
EGD412 egxSi136 II; unc-119(ed3) III egxSi136 [mex-5p::tomm-20::halotag::pie-1 3’UTR + unc-119(+)] II. Superficially wild-type. Stable expression of TOMM-20 tagged with Halo on the outer membranes of mitochondria in the germline and embryos. Reference: Fan X, et al. G3 (accepted).
EGD549 egxSi144 II; unc-119(ed3) III. egxSi144 [mex-5p::cox-4::halotag::pie-1 3’UTR + unc-119 (+)] II. Superficially wild-type. Stable expression of COX-4 tagged with Halo in the mitochondrial matrix in the germline and embryos. Reference: Fan X, et al. G3 (accepted).
EGD631 egxSi157 II; unc-119(ed3) III. egxSi157 [mex-5p::tomm-20::Dendra2::pie-1 3’UTR + unc-119(+)] II. Superficially wild-type. Stable expression of TOMM-20 tagged with photoconvertible Dendra2 on the outer membranes of mitochondria in the germline and embryos. Reference: Fan X, et al. G3 (accepted).
EGD615 cox-4(zu476[cox-4::eGFP::3XFLAG]) I; egxSi136 II; unc-119(ed3) III. egxSi136 [mex-5p::tomm-20::halotag::pie-1 3’UTR + unc-119(+)] II. GFP and 3xFLAG tags inserted into endogenous cox-4 locus to create a C-terminal translational GFP fusion. Outer membranes are stably labeled with the TOMM-20::Halotag transgene, and the mitochondria matrix are labeled with COX-4::GFP. Reference: Fan X, et al. G3 (accepted).
TBD307 dhc-1(he255[epdz::mCherry::dhc-1]) I; utdSi51 II. utdSi51[mex-5p::tomm-20(aa 1-55)::halotag::lov::tbb-2 3’UTR] II. Maintain at 23C and protect from light. Strain is sickly, seems to grow best and lay more eggs at 23C. Upon stimulation with 488nm light, the LOV-ePDZ optogenetic system will recruit mitochondria to the dynein heavy chain in the worm embryo. Embryonic cell divisions can be stopped by if mitochondrial recruitment is stimulated in early development. Room light can also induce mitochondria re-localization and cause infertility; store this strain in the dark. Reference: Fan X, et al. G3 (accepted).
HA2464 sod-1(tm776) II; rtSi8 IV; him-5 V; vsIs48. rtSi8 [sod-1p::sod-1(A4V) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. vsIs48 [unc-17::GFP]. A4V mutation in C. elegans sod-1 genomic rescue construct mimics human SOD1 disease model. Superficially wild-type with increased sensitivity to paraquat in multiple assays. GFP expressed in all cholinergic neurons. Strain reportedly carries a him-5 mutation in the background, though specific allele has not been confirmed. HA2619 serves as a control strain for HA2464. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.
HA2619 sod-1(tm776) II; rtSi1 IV. rtSi1 [sod-1p::sod-1(WT) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. Superficially wild-type. HA2619 serves as a control strain for HA2464. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.
HA2845 fust-1(rt255]) II. Superficially wild-type. This is the appropriate control strain for FUS disease models HA2846 and HA2847. This control strain contains presumably silent edits inserted by CRISPR editing while creating the FUS disease models in HA2846 and HA2847, and was back-crossed to remove the pha-1 allele used in strain construction. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
HA2846 fust-1(rt256[R446S]) II. fust-1(rt256[R446S]) was created by CRISPR editing of arginine codon in C. elegans fust-1 to create FUS disease model for human mutation R524S. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2846 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
HA2847 fust-1(rt257[P447L]) II. fust-1(rt257[P447L]) was created by CRISPR editing of proline codon in C. elegans fust-1 to create FUS disease model for human mutation P525L. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2847 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932
HA2825 smn-1(ok355) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); rtSi10 IV; nuIs175 X. rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752
HA2040 sir-2.4(n5137) I; sir-2.1(ok434) IV; sir-2.2(n5136) X. Superficially wild-type. Reference: Anderson E, et al.Mech Ageing Dev. 2016 Mar;154:30-42.
OG1124 ogt-1(dr84[ogt-1::GFP]) III. Endogenous ogt-1 locus tagged with C-terminal GFP. OGT-1::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. The OGT::GFP allele is functional. Superficially wild-type. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.
OG1139 ogt-1(dr84[ogt-1::GFP] dr89[K957M]) III. K957M mutation introduced into the endogenous ogt-1 locus tagged with C-terminal GFP. The K957M mutation ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. OGT-1(K957M)::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.
CG1367 pck-2(rg551) I; him-5(e1490) V. rg551 is an endogenous genomic CRISPR/Cas9 knock in of YFP fused to the C-terminus of the gene pck-2 in N2 background. Robust YFP fluorescence body wall muscle, intestine, hypodermis and pharyngeal muscle. Him. Reference: Goncalves J, et al. iScience 2020 Mar 19;23(4):100990. PMID: 32240955
LIU65 dhs-28(ldr5) X; ldrIs1; ldrIs2. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr5 is C-to-T causing S148F (Ser-Phe) substitution. Super-sized lipid droplets. [NOTE: The S148F site of the ldr5 mutation is correct and has been confirmed by sequencing. The positions indicated in Figure 1C of Xie, et al. (2019) are based on the unspliced + UTR sequences and do not reflect the position of the affected amino acid or position in a spliced transcript.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
JVR406 jerEx30. jerEx30 [ddr-2p::BiFC1 (EGFH1-LINK-SYN) + tph-1p::BIFC2 (SYN-EGFH2) + rol-6(su1006)]. Pick Rollers to maintain. a-Synuclein BiFC transfer strain is a model to investigate neuron-to-neuron α-syn transfer. Reference: Tyson T, et al. Sci Rep. 2017 Aug 8;7(1):7506.