Temperature sensitive; best grown at 15C. Lab and embryonic Mel phenotypes.

Heterozygotes are Unc. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT and segregate WT, DpyUnc and early larval lethals. Received new stock 5/98. Check carefully for segregation of Dpy Unc progeny; dpy-13 can be lost easily. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT and segregate WT, Unc L1 lethals and dead eggs (homozygous zen-4(w35)).

ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https://doi.org/10.17912/micropub.biology.000310) .

qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.

Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP q426 homozygotes (variable phenotypes including sterile, L1 lethal, and small sterile adults with rectal protrusion and occasional bent pharynx). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kadyk LC & Kimble J. Development. 1998 May;125(10):1803-13. doi: 10.1242/dev.125.10.1803. PMID: 9550713.

qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. teIs1 [oma-1::GFP + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. oma-1::GFP expression in oocyte cytoplasm. teIs1 rescues GFP expression in silenced germline trangenes more effectively at 25C. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.

mNeonGreen tag inserted into endogenous lag-1 locus. Upstream flanking sequence: CCTACAAATCATTGGAACGACATGGACCGTGCAGAATTGTGTCCAATTAC. Downstream flanking sequence: TAGATTGGTCTCTCGCGGGATTACTGTATCTTTATATTGTCTCCTAATTT. Guide sequence: ATTACTAGATTCCACTCTCG. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

wgIs494 [ztf-16::TY1::EGFP::3xFLAG + lag-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs591 [lag-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

CRISPR/Cas9 engineered tagged endogenous locus.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of lag-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous Mel. Deletion of 1641 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that give dead eggs (ve885 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TGGAGGGAGAAGATTGAGCTCATAGTGGAG; Right flanking sequence: TGGCAATTCTTAAACATCCAAATGCAATTG. plag-15 sgRNA A: CCTCCATCATCATACCCGAC; plag-15 sgRNA B: AGTATTTCAAGCTGATCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

stIs11650 [lag-1a::H1-wCherry + unc-119(+)].