More Fields
Strain Species Genotype
DR201 C. elegans dpy-13(e184) daf-14(m77) IV. Show Description
Temperature sensitive dauer constitutive. Dpy. Leaky double at 25C.
DR202 C. elegans unc-24(e138) daf-14(m77) IV. Show Description
Temperature sensitive dauer constitutive. Unc.
DR245 C. elegans daf-14(m77) unc-22(m52) IV. Show Description
Temperature sensitive dauer constitutive. Dominant Twitcher
DR442 C. elegans unc-8(e49) daf-14(m77) IV. Show Description
Temperature sensitive dauer constitutive. Unc.
DR77 C. elegans daf-14(m77) IV. Show Description
Temperature sensitive dauer constitutive. Tight at 25C. Leaky at 15C. Chemotaxis normal.
JJ938 C. elegans unc-24(e138) daf-14(m77)/elt-1(zu180) dpy-20(e1282) IV. Show Description
At 20C or 25C, heterozygotes are WT and segregate WT, UncDaf and dead eggs. At 15C, heterozygotes are WT and segregate WT, Uncs and dead eggs.
JT10189 C. elegans daf-14(m77) IV; scd-2(sa935) V. Show Description
Daf-c strongly but not completely suppressed; some dauers visible at 25C. sa935 alone is moderate Daf-d (dauer defective) in plate starvation assays, and resistant to exogenous dauer pheromone. sa935 confers strong suppression of daf-8 and daf-14, weak suppression of daf-1, -4, -7. scd-2(sa935) single mutant looks WT. snb-1(md247) hypomorph is an excellent balancer for scd-2; snb-1 is immediately neighboring. Maintain at 15 degrees.
PJ1194 C. elegans daf-14(m77) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Temperature-sensitive; constitutive dauer formation at 25C.
PJ1276 C. elegans daf-8(e1393) I; daf-14(m77) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature-sensitive. Some dauer formation at 16C.
FX776 C. elegans sod-1(tm776) II. Show Description
Homozygous viable. 612 bp deletion. 17154/17155 - 17766/17767. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GA187 C. elegans sod-1(tm776) II. Show Description
Superficially wild-type.
HA2464 C.elegans sod-1(tm776) II; rtSi8 IV; him-5 V; vsIs48. Show Description
rtSi8 [sod-1p::sod-1(A4V) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. vsIs48 [unc-17::GFP]. A4V mutation in C. elegans sod-1 genomic rescue construct mimics human SOD1 disease model. Superficially wild-type with increased sensitivity to paraquat in multiple assays. GFP expressed in all cholinergic neurons. Strain reportedly carries a him-5 mutation in the background, though specific allele has not been confirmed. HA2619 serves as a control strain for HA2464. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.
HA2619 C.elegans sod-1(tm776) II; rtSi1 IV. Show Description
rtSi1 [sod-1p::sod-1(WT) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. Superficially wild-type. HA2619 serves as a control strain for HA2464. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.
LC81 C. elegans cat-4(tm773) V. Show Description
Serotonin and dopamine-deficient, bleach hypersensitive, general chemical hypersensitivity, fragile cuticle. 652 bp deletion removes entire first exon. Derived by outcrossing FX773 five times to N2.
RM777 C. elegans cha-1(md39) IV. Show Description
Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, no long-term survival. The animals rapidly respond to temperature shift in either direction, even after more than an hour at the non-permissive temperature. Amino acid change: A499D Sequence data: AGAAAGCTGGAATTATTTAAGAAGG / C>A / TGTGCTCAAGCAGGTCAAGGTCACG (in direction of transcription). Reference: Rand JB. Genetics. 1989 May;122(1):73-80.
ZM7765 C. elegans unc-77(gk9); nca-2(gk5); hpIs166; hpEx3239. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3239 [lgc-55p::nca-1::GFP + nmr-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
ZM7798 C. elegans hpIs372. Show Description
hpIs372 [acr-5p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.