Search Strains

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. tbg-1(t1465) previously called sas-3(t1465).

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

sup-36 suppresses temperature sensitive lethal phenotype of e2123. Strain is viable at 15C and 25C. Dpy.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Temperature sensitive, maintain at 15C. At 25C, arrests at 1 to 24 cell stage. Will grow at 20C.

Maintain at 15C. Temperature sensitive. Will grow at 20C, but does better at 15C (viable, somewhat Unc). At 25C: 91% of eggs arrest at lima bean.

Temperature sensitive. Maintain at 15C. Some growth at 20C and 25.4C--very leaky.

Temperature sensitive, maintain at 15C. At 25.6C 80% of the eggs arrest at lima bean and have abnormal gut granule birefringence. Leaky at 25C. Will grow somewhat at 20C also.

Temperature sensitive, maintain at 15C. At 25C the eggs arrest at lima bean and have normal gut granule birefringence. Will grow at 20C.

Temperature sensitive. Maintain at 15C. Embryonic lethal at 25C.

Maintain by picking Unc GFP progeny that produce viable embryos and checking that the non-GFP progeny that are produced fail to give viable progeny. tm1310 is a homozygous sterile allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are Unc with pharyngeal GFP signal, and segregate Unc GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (tm1310 is maternally rescued; progeny of non-GFP animals fail to give viable progeny). Homozygous hT2 [bli-4 let-? qIs48] inviable. ok79 heterozygotes are Unc and segregate Uncs, dead eggs, and Him ok79 homozygotes (maternally rescued). Reference: Castellano-Pozo, García-Muse T, Aguilera A. 2012 R-loops cause replication impairment and genome instability during meiosis. EMBO Rep. 13(10): 923-9.

pkIs1201 [gpa-3::GFP + dpy-20(+)].

Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.

N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40.

Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.

Superficially wild-type. N-terminal tag of W08E12.7 via CRISPR/Cas9 knock-in of mNeonGreen at W08E12.7 locus. Insertion verified by PCR. Left flank: 5' ttcaatgtttattctttcagatagatcaaa 3'; Right flank: 5' ATGGTTAGAAAGGACAGTGAGAGTAGTTGTTCAAGTGATGG 3' (6 silent mutations). sgRNA: 5' GAAAGCAGCTGCTCCAGCGA 3'

N-terminal tag of H34C03.2 via CRISPR/Cas9 knock-in of mNeonGreen at H34C03.2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gggattgcctacactcaaatatacgtaacg 3'; Right flank: 5' ATGCCCACGCCGGAAGTGTTCCCATGGATG 3’ (4 silent mutations); gRNA: cgtaacgATGCCAACTCCCG; Cas9/sgRNA plasmid: pGLOW9; mNG^SEC^3xFlag plasmid: pGLOW106; SEC insertion allele strain: GLW72.

N-terminal tag of JNK-1 via CRISPR/Cas9 knock-in of mNeonGreen at jnk-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' cagcaagttaaagtgtgtgatcctgtgcac 3'; Right flank: 5' ATGGAGGAACGATTATCCACAACATCATCG 3’; gRNA: gtgtgatcctgtgcacATGG; Cas9/sgRNA plasmid: pGLOW114a; mNG^SEC^3xFlag plasmid: pGLOW116; SEC insertion allele strain: GLW76.

Slow growing. N-terminal tag of EEL-1 via CRISPR/Cas9 knock-in of mNeonGreen at eel-1 locus. Insertion verified by PCR. Left flank: 5' gacaagcgggttttttgaatcgtttcgaaa 3'; Right flank: 5' ATGAAGATTGACGATGCTGAGCCGAGCTCTAGTTCATCGGGCTCCGATAT 3' (6 silent mutations). sgRNA: 5' GACCCGGAAGAGCTTGAACT 3'

C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ GTCTCCACCAAACGCCTGTA 3’ ; rev – 5’ CTAGCCTGTGTCCCATCAGC 3’. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3’; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.

pgIs22 [unc-70::N-TSmod]. oxIs95 [pdi-2p::unc-70 + myo-2p::GFP]. The tension sensor module control (N-TSMod) was inserted at the N-terminus of unc-70. N-TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, but is placed at the N-terminus of UNC-70 where it is not sensitive to force. pgIs22 was a spontaneous insertion of pgEx157. Reference: Kelley M, et al. Elife. 2015 Mar 23;4.

pgIR4 (IV, CB4856>N2). CB4856 Chromosome IV in N2 background.

Constructed by crossing individual fluorescence knock-in worms. TagRFP inserted into the endogenous arx-2 gene at its C-terminus and GFP inserted into the endogenous wsp-1a gene at its N-terminus by Cas9-triggered homologous recombination.

Animals heterozygous for mnDp33 are Lon and segregate Lon and larval lethals. (Animals which have lost mnDp33 are larval lethal. Animals which are homozygous for mnDp33 are also larval lethal (L1-L2).)

Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366).

Temperature sensitive sterile at 25C. Maintain at 15C.

mgIs49 [mlt-10p::GFP::PEST + ttx-3::GFP] IV. GFP expression oscillates with molting cycle. Reference: Veli SM, et al. Mol Biol Cell. 2010 May 15;21(10):1648-61. PMID: 20335506.

mgSi3 [(pCMP2)ubl-1p::GFP::ubl-1-3'UTR + Cbr-unc-119(+)] IV. Strong ubiquitous GFP expression. Can be used as a control for a strain containing an endogenous siRNA sensor (GR1720). Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.

mgSi4 [(pCMP2)ubl-1p::GFP::siR-1-sensor-ubl-1-3'UTR + Cbr-unc-119(+)] IV. Very weak ubiquitous GFP expression. The 22G siR-1 sensor transgene is more sensitive to gene inactivations that affect 22G siR-1 levels when grown at 25C compared to 20C. Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.

mgSi2 [mut-16p::mut-16::GFP::mut-16 3'UTR + unc-119(+)] IV. MosSCI integrant of mut-16::GFP rescues pk710. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.

Superficially wild-type.

Superficially wild-type.  Mutation in active site of ddi-1 protease.

Superficially wild-type

CRISPR/Cas9 used to engineer a 6bp in-frame deletion in 5' coding region removing 2 amino acid residues that are conserved from yeast to human that might be critical for U1A binding to U1 snRNA Reference: Newman MA, et al. Genes Dev. 2018 May 1;32(9-10):670-681. PMID: 29739806

mgIs72 [rpt-3p::GFP + dpy-5(+)] II. mgIs78 [myo-3p::H2B::mCherry::SL2::pbs-5(T65A)] IV. Muscle-specific proteasome dysfunction. Reference: Lehrbach NJ & Ruvkun G. Elife. 2019 Apr 11;8. pii: e44425. doi: 10.7554/eLife.44425.

arIs36 [(pJF43) hsp::ssGFP + dpy-20(+) + pBluescript SK+]. GFP is secreted into the pseudocoelom upon heat shock and is taken up by coelomocytes. Not known where arIs36 is attached. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. GFP is secreted from muscle cells. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cup-5 is defective in endocytosis by coelomocytes. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cup-8 is defective in endocytosis by coelomocytes. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cup-9 is defective in endocytosis by coelomocytes. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cup-11 is defective in endocytosis by coelomocytes. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Coelomocyte endocytosis defect. GFP accumulates in body cavity. MTM-9=Y39H10A.3 mtm-9 pka cup-10. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. mca-3 is defective in endocytosis by coelomocytes. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. mca-3 is defective in endocytosis by coelomocytes. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cup-3 is defective in endocytosis by coelomocytes. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cup-2 is defective in endocytosis by coelomocytes. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cup-5(ar465) is defective in endocytosis by coelomocytes. Do not distribute this strain; other labs should request it from the CGC.