More Fields
Strain Species Genotype
DG4222 C. elegans pos-1(tn1730[gfp::3xflag::pos-1]) V. Show Description
Superficially wild type
JJ462 C. elegans +/nT1 IV; pos-1(zu148) unc-42(e270)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Uncs, Vul and dead eggs. Uncs are homozygous for zu148 and will segregate only dead embryos; the dead embryos will have no morphogenesis and will lack germ cells and intestine.
JJ1014 C. elegans mex-3(zu155) dpy-5(e61)/hT1 I; pos-1(zu148) unc-42(e270)/hT1 V. Show Description
The double heterozygote is WT. WT will segregate WT, DpyUncs, mid-larval lethal (hT1 homozygotes) and dead eggs. The DpyUncs are homozygous for zu155 and zu148 and will segregate only dead embryos; the dead embryos have excess hypodermis and muscle and lack germ cells and intestine.
EGD224 C. elegans egxSi100 II; unc-119(ed3) III. Show Description
egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. Reference: Han et al, Current Biology 2017.
EGD226 C. elegans egxSi101 II; unc-119(ed3) III. Show Description
egxSi101 [mex-5p::GFP::pos-1(F121N & F164N) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the one-cell zygote. Reference: Han et al, Current Biology 2017.
EGD263 C. elegans egxSi100 II; unc-119(ed3) III; mex-5(egx1[F294N & F339N]) IV. Show Description
egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. mex-5(egx1[F294N, F339N]) modifies the endogenous mex-5 locus to disrupt zinc finger motifs. Reference: Han et al, Current Biology 2017.
EGD271 C. elegans egxSi109 II; unc-119(ed3) III. Show Description
egxSi109 [mex-5p::GFP::pos-1(S199A, S210A, S216A, S237A & T242A) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the cytoplasm of the one-cell zygote. Reference: Han et al, Current Biology 2017.
EGD273 C. elegans egxSi110 II; unc-119(ed3) III. Show Description
egxSi110 [mex-5p::GFP::pos-1(S199D, S210D, S216D, S237D & T242D) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the cytoplasm of the one-cell zygote. Reference: Han et al, Current Biology 2017.
EGD282 C. elegans egxSi100 II; unc-119(ed3) III; mex-5(egx2[T186A]) IV. Show Description
egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1 forms a weaker gradient in the cytoplasm of the one-cell zygote than in wild-type. Reference: Han et al, Current Biology 2017.
EGD334 C. elegans egxSi100 II; plk-1(egx3[C52V, L115G]); unc-119(ed3) III. Show Description
egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. Reference: Han et al, Current Biology 2017.
JH2427 C. elegans unc-119(ed3) III; axIs1751. Show Description
axIs1751 [pie-1p::GFP::histone H2B::pos-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
OP475 C. elegans unc-119(tm4063) III; wgIs475. Show Description
wgIs475 [pos-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP503 C. elegans unc-119(tm4063) III; wgIs503. Show Description
wgIs503 [pos-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
SS712 C. elegans ife-1(bn127) III. Show Description
Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt//tgatgaaaattaattgtatt. The ife-1 gene is the third in an operon, but the deletion is contained completely within the ife-1 gene.