Search Strains

Superficially wild type

Heterozygotes are WT and segregate WT, Uncs, Vul and dead eggs. Uncs are homozygous for zu148 and will segregate only dead embryos; the dead embryos will have no morphogenesis and will lack germ cells and intestine.

The double heterozygote is WT. WT will segregate WT, DpyUncs, mid-larval lethal (hT1 homozygotes) and dead eggs. The DpyUncs are homozygous for zu155 and zu148 and will segregate only dead embryos; the dead embryos have excess hypodermis and muscle and lack germ cells and intestine.

egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. Reference: Han et al, Current Biology 2017.

egxSi101 [mex-5p::GFP::pos-1(F121N & F164N) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the one-cell zygote. Reference: Han et al, Current Biology 2017.

egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. mex-5(egx1[F294N, F339N]) modifies the endogenous mex-5 locus to disrupt zinc finger motifs. Reference: Han et al, Current Biology 2017.

egxSi109 [mex-5p::GFP::pos-1(S199A, S210A, S216A, S237A & T242A) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the cytoplasm of the one-cell zygote. Reference: Han et al, Current Biology 2017.

egxSi110 [mex-5p::GFP::pos-1(S199D, S210D, S216D, S237D & T242D) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the cytoplasm of the one-cell zygote. Reference: Han et al, Current Biology 2017.

egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1 forms a weaker gradient in the cytoplasm of the one-cell zygote than in wild-type. Reference: Han et al, Current Biology 2017.

egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. Reference: Han et al, Current Biology 2017.

axIs1751 [pie-1p::GFP::histone H2B::pos-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.

wgIs475 [pos-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

wgIs503 [pos-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt//tgatgaaaattaattgtatt. The ife-1 gene is the third in an operon, but the deletion is contained completely within the ife-1 gene.

spr28 is a 239-nucleotide deletion (bp 45-285) and insertion of a jump board gRNA sequence (Duan et al. 2020) within the 3' UTR of the endogenously-tagged pos-1 locus. GFP::POS-1 protein expression is mis-regulated causing overexpression throughout the gonad where it is not normally expressed. A large portion of progeny fail to properly develop a germline. Other phenotypes include reduced brood size, reduced hatch rate, hermaphrodites developing only one gonad arm, oogenesis defects, and multi-vulva. Temperature stress of 25C increases severity of phenotypes. Generated in DG4222 background that was 3x outcrossed. Reference: Varderesian HV, et al. PLoS Genet. 2026 Apr 27;22(4):e1012129. doi: 10.1371/journal.pgen.1012129. PMID: 42044121.

spr29 is a 239-nucleotide deletion (bp 45-285) and insertion of a jump board gRNA sequence (Duan et al. 2020) within the 3' UTR of the endogenously-tagged pos-1 locus. A small portion of homozygous progeny fail to properly develop a germline, rendering those animals sterile. No impact on brood size or hatch rate. Temperature stress of 25C reduces brood size and marginally increases observed sterility rate. Generated in N2 background. Reference: Varderesian HV, et al. PLoS Genet. 2026 Apr 27;22(4):e1012129. doi: 10.1371/journal.pgen.1012129. PMID: 42044121.

mCherry tag inserted at N-terminus of endogenous pgl-1 locus. mCherry fluorescence in P-granules throughout embryogenesis and larval morphogenesis. spr28 is a 239-nucleotide deletion (bp 45-285) and insertion of a jump board gRNA sequence (Duan et al. 2020) within the 3' UTR of the endogenously-tagged pos-1 locus. GFP::POS-1 protein expression is mis-regulated causing overexpression throughout the gonad where it is not normally expressed. A large portion of progeny fail to properly develop a germline. Other phenotypes include reduced brood size, reduced hatch rate, hermaphrodites developing only one gonad arm, oogenesis defects, and multi-vulva. Temperature stress of 25C increases severity of phenotypes. Derived by crossing WRM101 males with WRM85 hermaphrodites. Reference: Varderesian HV, et al. PLoS Genet. 2026 Apr 27;22(4):e1012129. doi: 10.1371/journal.pgen.1012129. PMID: 42044121.

mCherry tag inserted at N-terminus of endogenous pgl-1 locus. mCherry fluorescence in P-granules throughout embryogenesis and larval morphogenesis. GFP::POS-1 expression in embryos. Derived by crossing WRM85 males with DG4222 hermaphrodites that had been 3x outcrossed. A small portion of homozygotes fail to properly develop germline. Reference: Varderesian HV, et al. PLoS Genet. 2026 Apr 27;22(4):e1012129. doi: 10.1371/journal.pgen.1012129. PMID: 42044121.