| JK1277 |
C. elegans |
lag-2(q420) V. Show Description
Temperature sensitive. Maintain at 15C. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK2049 |
C. elegans |
qIs19 V. Show Description
qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Rollers. Integration of qEx233. GFP expression in DTCs and other defined regions. Do not distribute this strain; other labs should request it directly from the CGC.
|
|
| JK2157 |
C. elegans |
lag-2(q411) V; qEx319. Show Description
qEx319 [lag-2::cMyc + rol-6(su1006)]. Rollers. Extrachromosomal array carrying myc-tagged LAG-2 protein partially rescues lag-2(null). About 70% of progeny are Lag. Survivors are Rollers. Reference: Crittenden et al., Mol Biol Cell. 2006 Jul;17(7):3051-61.
|
|
| JK2868 |
C. elegans |
qIs56 V. Show Description
qIs56 [lag-2p::GFP + unc-119(+)]. Non-unc; might still have unc-119(ed3) in background. Do not distribute this strain; other labs should request it directly from the CGC.
|
|
| JT37 |
C. elegans |
lag-2(sa37) V. Show Description
Semidominant suppressor of lin-12(d) alleles.
|
|
| JT5205 |
C. elegans |
lin-12(n950) III; lag-2(sa37) V. Show Description
lag-2(sa37) is a semi-dominant suppressor of lin-12(n302sd).
|
|
| JK1223 |
C. elegans |
lag-2(q411) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. [Used to be listed in Kimble lab as unc-5(e53); lag-2(q411 dpy-11(e224)/DnT1. Needs to be checked.] Do not distribute this strain; other labs should request it from the CGC.
|
|
| BC3670 |
C. elegans |
dpy-18(e364)/eT1 III; lag-2(s1486) unc-46(e177)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval, mid-larval at 15C. Maintain by picking WT. Previously called let-461(s1486).
|
|
| JK1219 |
C. elegans |
unc-34(e315) lag-2(q387) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. [Note from Kimble lab: Min Han did a complementation test on this strain and found that unc-34(e315) is lost from this strain.] Do not distribute this strain; other labs should request it from the CGC.
|
|
| YG1011 |
C. elegans |
baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qIs19 V. Show Description
qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile and Unc). All worms express lag-2p::GFP at the distal tip cells. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
|
|
| BN558 |
C. elegans |
bqSi294 II; bqSi556 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi556 [lag-2p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in lag-2 expressing cells and red nuclei elsewhere.
|
|
| CV98 |
C. elegans |
him-18(tm2181)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygous animals show roller phenotype and GFP signal at the distal tip cells. Segregates roller GFP(+) heterozygotes, wild-type moving GFP(-) him-18(tm2181) homozygotes. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygous animals are dead. P0 him-18(tm2181) homozygous animals show 80% embryonic lethality and 12% high incidence of male at F1. Pick roller GFP(+) worms to maintain. Reference: Saito TT, et al. (2009) PLoS Genet 5:e1000735.
|
|
| DQM1051 |
C. elegans |
lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
| DQM1066 |
C. elegans |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
| DQM1068 |
C. elegans |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
| DQM1070 |
C. elegans |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
|
|
| DQM1072 |
C. elegans |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
|
|
| EU3020 |
C. elegans |
cls-2(or1948)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. or1948 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1948 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.
|
|
| EU3023 |
C. elegans |
cls-2(or1951)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. or1951 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1951 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.
|
|
| JH2691 |
C. elegans |
npp-10(ok467)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. ok467 deletion balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and npp-10 homozygotes (Emb or early Larval lethal). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain.
|
|
| JK2176 |
C. elegans |
sys-1(q544)/qIs23 I. Show Description
qIs23 [lag-2::GFP]. Heterozygous. Segregates fertile and rolling heterozygotes, sterile and non-rolling sys-1 homozygotes, and dead qIs23 homozygotes. Maintain by picking rollers. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK2533 |
C. elegans |
qC1 [dpy-19(e1259) glp-1(q339) qIs26] III/eT1 (III;V). Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Throws heterozygous Rollers and Unc eT1 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. It was an integration of qEx233. Do not distribute this strain; other labs should request it directly from the CGC.
|
|
| JK3782 |
C. elegans |
qIs56 him-5(e1490) V; qEx557. Show Description
qIs56 [lag-2p::GFP + unc-119(+)] V. qEx557 [hsp-16p::ceh-22b + ttx-3::DsRed]. Him. Pick DsRed+ animals to maintain qEx557 array. Heat-shock can be used to drive the ectopic expression of CEH-22B (derived from Fire Lab vector pPD49.78). LAG-2::GFP is expressed the embryo, nerve cord, Z1/Z4, and DTCs. Reference: Lam N. et al. Curr Biol. 2006 Feb 7;16(3):287-95. doi: 10.1016/j.cub.2005.12.015. PMID: 16461282
|
|
| JK3965 |
C. elegans |
fbf-1(ok91) fbf-2(q704)/mIn1 [mIs14 dpy-10(e128)] II; fem-3(e1996)/qIs24 IV. Show Description
qIs24 [lag-2p::GFP]. Maintain by picking individual animals with green DTCs and green pharynx and scoring offspring for Fems and Fbfs. fem-3 is not well balanced by qIs24. fbf-1 fbf-2 homozygotes are germline proliferation defective and make only sperm. fem-3 homozygotes make only oocytes. fbf-1 fbf-3; fem-3 proliferates more than fbf-1 fbf-2 and makes only oocytes; also Muv. qIs24 contains lag-2::GFP; Distal Tip Cells are green; homozygotes are Rollers and heterozygotes Roll weakly. mIn1 is Dpy and GFP+ in the pharynx. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK4143 |
C. elegans |
qIs57 II; rde-1(ne219) V; qIs140. Show Description
qIs57 [lag-2p::GFP] II. qIs140 [lag-2p::rde-1 + rol-6(su1006)]. Rollers. qIs140 rescues rde-1 in lag-2-expressing cells (as tested by GFP RNAi). qIs57 GFP expression in DTCs. Do not distribute this strain; other labs should request it directly from the CGC.
|
|
| JK4472 |
C. elegans |
qIs154 V. Show Description
qIs154 [lag-2p::MYR::tdTomato + ttx-3p::GFP] V. Myristylated tdTomato localizes to plasma membrane of DTC and other lag-2-expressing cells. Reference: Byrd DT, et al. PLoS One. 2014 Feb 19;9(2):e88372.
|
|
| JK4475 |
C. elegans |
qIs153 V. Show Description
qIs153 [lag-2p::MYR::GFP + ttx-3p::DsRed] V. Myristylated GFP localizes to plasma membrane of DTC and other lag-2-expressing cells. Reference: Byrd DT, et al. PLoS One. 2014 Feb 19;9(2):e88372.
|
|
| JK6099 |
C. elegans |
lag-2(q1049[lag-2::3xV5]) V. Show Description
CRISPR/Cas9 gene editing was used to insert a 3xV5 tag at the C-terminus of the endogenous lag-2 locus immediately upstream of stop codon. Animals are fertile and express LAG-2 V5 in adult DTCs.
|
|
| JN218 |
C. elegans |
asb-1(tm498)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm498) is homozygous sterile.
|
|
| JN219 |
C. elegans |
asb-1(tm499)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. asb-1(tm499) is homozygous sterile.
|
|
| KIR1 |
C. elegans |
smc-4(tm1868) III/qC1 [dpy-19(e1259) glp-1(q339) qIs26] (III). Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Rollers. Homozygous sterile deletion allele tm1868 balanced by qC1 with rol and GFP markers. Segregates GFP + Roller heterozygotes, and non-rol non-GFP tm1868 homozygotes (sick, sterile, unc). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Pick Rol GFP+ and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.
|
|
| KW2211 |
C. elegans |
ckSi26 I; cdk-12(ok3664)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).
|
|
| MLC218 |
C. elegans |
tbx-37(zu467) dpy-18(e364) tbx-38(zu460)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| MLC270 |
C. elegans |
tbx-37(tm314) tbx-38(tm581)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| NK3085 |
C. elegans |
cpIs91 II; immt-1(qy230[immt-1::mNG]) X. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous immt-1 locus. lag-2 driven red plasma membrane marker.
|
|
| NK3086 |
C. elegans |
cpIs91 II; ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous ucr-2.1 locus. lag-2 driven red plasma membrane marker.
|
|
| NK3087 |
C. elegans |
cpIs91 II; nduv-2(qy174[nduv-2::mNG]) V. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous nduv-2 locus. lag-2 driven red plasma membrane marker.
|
|
| NK3234 |
C. elegans |
cpIs91 II; crls-1(qy255[crls-1::mNG]) III. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous crls-1 locus. lag-2 driven red plasma membrane marker.
|
|
| PFR510 |
C. elegans |
set-2(bn129)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
Maintain at 20C or cooler. qIs26 [lag-2::GFP + rol-6(su1006)]. set-2 mutation balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and set-2(bn129) homozygotes (Mrt phenotype at 25C -- viable but homozygotes will become sterile in successive generations). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. set-2(bn129) homozygotes are short-lived on OP50. bn129 is a deletion removing 748 bp from exon 11 of SET-2L and from exon 3 of SET-2S resulting in a frameshift after 885 aa of SET-2L and after 117 aa of SET-2S with a premature stop four codons later. References: Robert VJ, et al. Front Cell Dev Biol. Dec 2020 Sep 22:8:561791.
doi: 10.3389/fcell.2020.561791. PMID: 33072747. Xiao Y, et al. Proc Natl Acad Sci USA. 2011 May 17;108(20):8305-10. doi: 10.1073/pnas.1019290108. PMID: 21527717.
|
|
| PHX2171 |
C. elegans |
set-2(syb2085)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
Maintain at 20C or cooler. qIs26 [lag-2::GFP + rol-6(su1006)]. set-2 mutation balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and set-2(syb2085) homozygotes (Mrt phenotype at 25C -- viable but homozygotes will become sterile in successive generations). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. set-2(syb2085) mutant animals that express a catalytically inactive form of SET-2, the C. elegans SET1 homolog. set-2(syb2085) homozygotes are not long-lived on OP50. Reference: Caron M, et al. Life Sci Alliance. Dec 2021, 5 (3) e202101140; DOI: 10.26508/lsa.202101140. PMID: 34893559.
|
|
| RG3161 |
C. elegans |
Y53G8AR.6(ve661[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26]III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Homozygotes are unhealthy. Deletion of 1671 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) unhealthy animals (ve661 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aaaaatccgctagaaaccgtctaaaaacct ; Right flanking sequence: AGGCTTCACGTGCTGAAAGATTCGGAATTA. sgRNA #1: atcaatagcgtaggctttac; sgRNA #2: ACTAACATCAAATGACGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3438 |
C. elegans |
let-767(ve938[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Larval lethal. Deletion of 1104 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) early larval lethal (ve938 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: ATCCATGAGCTCGAGTTGAAGTTGATGCGT; Right flanking sequence: TGGAATTTACAGAATTTCAATGGAAATAAC. let-767 sgRNA A: GATGTATCCGGTGGTGTCTG; let-767nsgRNA B: CACTGGCAAGCCATGTTACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3440 |
C. elegans |
rnp-7(ve940[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Maintain by picking GFP+ Rollers (GFP expression in both pharynx and distal tip cells). Heterozygotes are Rol GFP+ (GFP expression in both pharynx and distal tip cells), and segregate Rol GFP+ (GFP expression in both pharynx and distal tip cells), non-Rol GFP+ (GFP only in pharynx) ve940 homozygotes (Unc, arrest as larvae with a curled tail). qC1[qIs26] is homozygous lethal (unknown stage). Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCTTCGATATCCACCACCGGATCCTCCA; Right flanking sequence: TGGAAGATATTGCACTGGTGGTCGTGCTTC. rnp-7 sgRNA A: GGAAGCCGATACAGTACAGG; rnp-7 sgRNA B: ACTAGTAGGTCCTGGCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3441 |
C. elegans |
arx-6(ve941[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Sterile. Deletion of 651 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) grotty adults with vulval blip (ve941 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: GCGTCACACGCTCCAGGCAGCTCTCTGTCT; Right flanking sequence: GAATTTTTGAAGCGTTTCAATTAAttttct. arx-6 sgRNA A: TGAGCAATTCAGTTCGCAGG; arx-6 sgRNA B: TTCAGCAGAAACACGGGCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3478 |
C. elegans |
let-805(ve978[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Emb. Deletion of 22058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), dead embryos (ve978 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: aggtagaaaaaatgtagactagccccccct; Right flanking sequence: tcgttttccaaattaatcagaaattagcat. let-805 sgRNA #1: tgagtcagcagaggccgggg; let-805 sgRNA B: attacGTTGGGTTGCAGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3493 |
C. elegans |
rars-1(ve993[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Larval arrest. Deletion of 2015 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve993 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Note: this strain exhibits ectopic body wall GFP expression. Left flanking Sequence: aaggctcgacatgtaattacacacatacCT; Right flanking sequence: AGGGGAACATCAAGTCCAGGGAATGCATCT. rars-1 crRNA A: GTTATTGAAAATAAGGAAGG; rars-1 crRNA B: TTGGAGTTTCAGCGAGGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3502 |
C. elegans |
madf-11(ve1002[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Mel. Deletion of 2623 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) adults that give progeny that die early (ve1002 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: AAAGTTAAATATTGATGTTGAAGTTTGCCT; Right flanking sequence: ATTTTTAATAATAATTCTGAAATTTATTTT. madf-11 crRNA A: GTTCCCATTGAAAAATCACC; madf-11 crRNA B: TTCCAATGAGCGACCGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3504 |
C. elegans |
gars-1(ve1004[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Larval arrest. Deletion of 1643 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve1004 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: TGTAACTCATCTCAAAGCGTGAGAGTTCCT; Right flanking sequence: ATCATAGAAGAATCGTCTTTTGAGAAGATC. gars-1 crRNA A: AGTTATGGATGCCGTTAAGG; gars-1 crRNA B: CAATCATTTGCTATCTATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3533 |
C. elegans |
mrps-34(ve1033[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Larval arrest. Deletion of 1120 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve1033 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: AAACCTGAGTTTATTTACGCAAATTCGCCA; Right flanking sequence: CGGAGTTGTGAGAGAATCTCGAACAAAAAC. mrps-34 crRNA A: AGAAACGAACCAAACATCAG; mrps-34 crRNA B: CAGCAGAATAACATACGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| TY3837 |
C. elegans |
dpy-28(y402)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Segregates GFP+ Roller heterozygotes, and non-GFP y402 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal.
|
|