| DG4213 |
C. elegans |
meg-1(tn1724[gfp::3xflag::meg-1]) X. Show Description
Superficially wild type |
|
| RB2298 |
C. elegans |
K02B9.1(ok3121) X. Show Description
K02B9.1 Homozygous. Outer Left Sequence: agagcatcggcttcagtgtt. Outer Right Sequence: aggatatcaccgacgtgagc. Inner Left Sequence: gggagcgtcacctaaaatga. Inner Right Sequence: ggaatgagaatcgggaatca. Inner Primer PCR Length: 1247. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| YL139 |
C. elegans |
meg-1(vr10) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: AGATGCCACATACAAACGCT / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306. |
|
| YL140 |
C.elegans |
meg-1(vr11) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: CAGTTCCAAATGAATCAAAG / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306. |
|
| JH3148 |
C. elegans |
ltIs37 IV; meg-1(vr10) X; axIs1522. Show Description
axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Wang JT, et al. eLife 2014;3:e04591. |
|
| JH3229 |
C. elegans |
meg-1(vr10) meg-3(tm4259) X. Show Description
P granule defect. Some sterility. Reference: Wang JT, et al. eLife 2014;3:e04591. |
|
| VC2678 |
C. elegans |
Y47G6A.5(gk1100) I; meg-1&K02B9.3(gk1205) X. Show Description
Y47G6A.5, K02B9.1, K02B9.3. External left primer: TAGGGAATATCGATCGGCTG. External right primer: CGCGTCAATCATGGTGTATC. Internal left primer: TTCAACTACCGTAGCCGAGG. Internal right primer: GATCCGAAATGAATAACCGC. Internal WT amplicon: 1768 bp. Deletion size: 371 bp. Deletion left flank: TAACATTTCGCGGCATCCATCAGCAACTTC. Deletion right flank: GCAACTTTTTCAAAATTAAAAAAAAACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| JH3150 |
C. elegans |
ltIs37 IV; meg-1(vr10) meg-3(tm4259) X; axIs1522. Show Description
axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591. |
|
| JH3156 |
C. elegans |
ltIs37 IV; pptr-1(tm3103) V; meg-1(vr10) X; axIs1522. Show Description
axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591. |
|
| JH3379 |
C. elegans |
meg-1(ax4534[meg-1::gfp]) X. Show Description
GFP tag inserted at C-terminus of the endogenous meg-1 locus by CRISPR. Reference: Cassani M & Seydoux G. Development 2022 Nov 1;149(21):dev200920. doi: 10.1242/dev.200920. PMID: 36196602. |
|
| JH3407 |
C. elegans |
meg-1(ax4535[meg-1::OLLAS]) X. Show Description
OLLAS tag inserted at C-terminus of the endogenous meg-1 locus by CRISPR. Reference: Cassani M & Seydoux G. Development 2022 Nov 1;149(21):dev200920. doi: 10.1242/dev.200920. PMID: 36196602. |
|
| JH4877 |
C. elegans |
nos-2(egx211[7xHA::nos-2]) II; meg-1(vr10) X. Show Description
7xHA tag inserted at N-terminus of endogenous nos-2 locus. Minor maternal effect sterility at 20C; increased sterility at 25C. Derived by crossing parental strains YL139 and JH4876. NOTE: egx211 was originally designed as 8xHA tag but sequencing confirmed a point mutation disrupts one repeat, making it a functional 7xHA tag. egx211 CRISPR Guide sequence: TTCTTCTTGAAAGATGTCTC. Reference: Simmons WR, et al. 2026 bioRxiv 2026.07.01.735846; doi: https://doi.org/10.64898/2026.07.01.735846. |
|