Green body muscle filaments, slightly sluggish movement. Functional translational fusion that provides a means to observe striated muscle thick filaments in real time. Reference: Nature. 2016 Jun 30;534(7609):719-23.

Endogenous unc-54::GFP made by CRISPR. Exhibits green thick muscle filaments in the body wall muscle. Weakly Unc. Reference: Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. Translation readthrough mitigation. Nature. 2016 Jun 30;534(7609):719-23. Epub 2016 Jun 1.

cc2882 is a CRISPR/Cas9-induced G387R mutation of unc-54 in parental strain PD2859, mimicking the molecular lesion e1301. Unc at room temperature. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292.

Unc. Reporter for non-stop mRNA decay, separate from non-stop protein decay. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292.

CRISPR/Cas9 engineered tagged endogenous locus.

rmIs132 [unc-54p::Q35::YFP]. AM140 animals show a Q35::YFP progressive transition from soluble to aggregated as they age.

Paralyzed Rigid Unc. Muscle birefrigence normal. Muscle normal in EM.

Unc. Suppressed by sup-5 and sup-7.

Paralyzed Unc. Null allele.

Paralyzed Unc. Null allele.

Slow moving Unc.

Temperature sensitive. Unc. Recessive. Dominant Slow.

Paralyzed Unc. Null allele.

Paralyzed Unc. Null allele.

Paralyzed Unc. Null allele.

Unc. Suppressed by sup-5 and sup-7. Null allele? Milder than most null.

Temperature sensitive Unc.

Paralyzed Unc. Severe phenotype. Recessive. Null allele.

Unc. Suppressed by sup-5 and sup-7.

Semi-paralyzed Unc. Null allele. Recessive. M-MATING-NO SUCCESS.

Paralyzed Unc.

Slow movement.

Slow moving Unc. Semi-dominant.

Stiff. Body muscle abnormal.

dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.

Severe Unc. Very slow growth. Strong semi-dominant. Heterozygous males don't mate.

Severe Unc. Growth slow. Recessive.

Movement very slow. Recessive.

Moves relatively well. Recessive.

Severe homozygous Unc. Heterozygotes are slow moving. Weakly semi-dominant. Body muscle abnormal.

Healthy. Recessive. Dauer recovery slow. Eggs laid rarely.

Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427.

Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427. [Jan 2007: Taylor Allen suggests that st132 may have a temperature sensitive phenotype.]

Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427.

Dominant suppressor of unc-22(s12). See WBG 9(1):22 and WBG 9(2):18 and C. elegans II page 427.

Paralyzed Rigid Unc. Muscle birefrigence is normal. Muscle is normal in EM.

Unc.

Movement slow. Unc partially suppressed.

Suppressed Unc.

dvIs15 [(pPD30.38) unc-54(vector) + (pCL26) mtl-2::GFP]. Control strain for CL2120. Phenotype apparently WT.

Suppressed-movement slow. Unlinked double.

Suppressed-movement slow.

Not suppressed. Unc-slow moving.

ccIs126 [myo-2p::lacZ + unc-54(+)]. lacZ expression in pharyngeal and body wall muscles. Superficially wild-type, but gives some paralyzed animals.

ccIs55 [unc-54::lacZ + sup-7(st5)] V.

Homozygous viable. Deletion of 527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgtatatatgtgcatttcgagcaacaaca ; Right flanking sequence: cggtttttatacatccaaattgagatcggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. 2996 bp deletion removes his-31, his-32, his-33 and his-34, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAGAGCATAGACGACGTCCATAGCAGTTA ; Right flanking sequence: CCTAATTGAGTTGTTCCAATAAAATTTTCA. sgRNA #1: CGAGCACGCCAAGAGAAAGA; sgRNA #2: TCTTTCAGAACAACATCTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1936 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGTTGCAGAAGTTGAACTCACTGTAACCA. Right flanking sequence: TGGACTGATGAGTAGAATGACAGGCGGTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.