AG171 |
C. elegans |
mdf-1(av19) unc-42(e270) V. Show Description
Unc. Previously called AG164 by the CGC.
|
|
BC1572 |
C. elegans |
+/eT1 III; let-401(s193) dpy-11(e224) unc-42(e270)/eT1 V. Show Description
WT strain which segregates WT, Unc-36, dead eggs and DpyUncLets. Lethal mid-larval. Maintain by picking WT.
|
|
BC1573 |
C. elegans |
+/eT1 III; let-402(s127) dpy-11(e224) unc-42(e270)/eT1 V. Show Description
WT strain which segregates WT, Unc-36, dead eggs and DpyUncLets. Lethal mid larval. Maintain by picking WT.
|
|
BC1574 |
C. elegans |
+/eT1 III; let-403(s120) dpy-11(e224) unc-42(e270)/eT1 V. Show Description
WT strain which segregates WT, Unc-36, dead eggs and DpyUncLets. Lethal mid-late larval. Maintain by picking WT.
|
|
BC2590 |
C. elegans |
dpy-18(e364)/eT1 III; dpy-11(e224) let-404(s119) unc-42(e270)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.
|
|
BC2910 |
C. elegans |
dpy-18(e364)/eT1 III; let-422(s194) dpy-11(e224) unc-42(e270)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
|
|
BC2991 |
C. elegans |
dpy-18(e364)/eT1 III; dpy-11(e224) let-413(s128) unc-42(e270)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Egg lethal. Maintain by picking WT.
|
|
BC3016 |
C. elegans |
dpy-18(e364)/eT1 III; dpy-11(e224) let-416(s113) unc-42(e270)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Late larval lethal. Maintain by picking WT.
|
|
BC3017 |
C. elegans |
dpy-18(e364)/eT1 III; dpy-11(e224) let-414(s114) unc-42(e270)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.
|
|
BC3019 |
C. elegans |
dpy-18(e364)/eT1 III; dpy-11(e224) let-415(s129) unc-42(e270)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Mid-late larval lethal. Maintain by picking WT.
|
|
BC3020 |
C. elegans |
dpy-18(e364)/eT1 III; dpy-11(e224) let-408(s195) unc-42(e270)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal late larval. Maintain by picking WT.
|
|
BC3021 |
C. elegans |
dpy-18(e364)/eT1 III; let-417(s204) dpy-11(e224) unc-42(e270)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
|
|
BW1118 |
C. elegans |
mel-25(ct60) unc-42(e270)/unc-23(e25) vab-8(e1017) V; lon-2(e678) X. Show Description
Maintain by picking Lon non-Unc. Throws Lon non-Unc, Lon Unc Vab (bent head, tails very thin), and Lon Unc Mel (kinker, temperature-sterile).
|
|
BW1199 |
C. elegans |
him-8(e1489) IV; unc-42(e270) sma-1(e30) V; ctDp8[vab-8(e1017)] (V;f). Show Description
|
|
BW1434 |
C. elegans |
dpy-17(e164) III; him-8(e1489) IV; her-1(y101hv1) unc-42(e270) V; ctDp11 (III;V;f). Show Description
Wild type hermaphrodites and males which produce WT, Dpy, Unc and DpyUnc progeny due to mating or loss of the duplication. Pick WT hermaphrodites and males to maintain.
|
|
BW1946 |
C. elegans |
ctIs43 unc-42(e270) V. Show Description
Unc. ctIs43 [dbl-1p::GFP + dbl-1p::GFP::NLS + unc-119(+)].
|
|
CB1951 |
C. elegans |
unc-42(e270) sma-1(e30) V. Show Description
Small. Unc. Linked closely.
|
|
CB2222 |
C. elegans |
unc-42(e270) unc-41(e268) V. Show Description
Growth slow. Severe Unc. Linked closely.
|
|
CB270 |
C. elegans |
unc-42(e270) V. Show Description
Unc. Recessive. Mapping marker standard. M-MATING+POOR <1%WT.
|
|
CB2810 |
C. elegans |
tra-1(e1575)/+ III; unc-42(e270) him-5(e1490) dpy-21(e428) V. Show Description
Pick Unc hermaphrodite to maintain (these will be tra-1/+; unc-42 him-5 dpy-21 XO animals). Segregates Unc hermaphrodites (tra-1/+ III), Unc males (+/+ III), and DpyUnc hermaphrodites (+/+ III). dpy-21 not expressed in XO. dpy-21(e428) V; XX animals are weak Dpy. dpy-21(e428) V; XO animals are non-Dpy.
|
|
CB5378 |
C. elegans |
unc-42(e270) let-560(e2658) V/nT1 (IV;V). Show Description
let-560(e2658) was a spontaneous mutation in strain DH424. let-560 homozygotes are late embryonic lethal. Strain segregates WT, Vul and dead eggs.
|
|
CGC138 |
C. elegans |
unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs79] V. Show Description
umnIs79 [myo-2p::GFP + NeoR, I: 6284001] I. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, arrested hT1 homozygotes (GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
CGC139 |
C. elegans |
unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs80] V. Show Description
umnIs80 [myo-2p::mKate2 + NeoR, I: 6284001] I. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
CGC29 |
C. elegans |
unc-13(e51)/hT1 [umnIs18] I; dpy-11(e224)/hT1 [unc-42(e270)] V. Show Description
umnIs18 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Dpy Unc, arrested hT1 homozygotes(GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
CGC75 |
C. elegans |
unc-13(e51)/hT1 [umnIs58] I; dpy-11(e224)/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
DA443 |
C. elegans |
rol-3(e754) unc-42(e270) V. Show Description
Roller Unc. e754 is cold-sensitive: lethal at 15C.
|
|
DR1056 |
C. elegans |
unc-42(e270) ama-2(m323) V/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs. (Chromosome carrying unc-42 ama-2 is homozygous lethal.) Strain is resistant to _-amanitin.
|
|
DR108 |
C. elegans |
dpy-11(e224) unc-42(e270) V. Show Description
DpyUnc.
|
|
DR240 |
C. elegans |
dpy-11(e224) unc-42(e270) daf-11(m84) V. Show Description
Temperature sensitive dauer constitutive. Dpy. Unc.
|
|
DR789 |
C. elegans |
dpy-13(e184) IV/nT1 [let-?(m435)] (IV;V); unc-42(e270) V/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
|
|
EU423 |
C. elegans |
dpy-5(e61) mom-4(or39)/hT1 I; mom-2(or42) unc-42(e270)/hT1 V. Show Description
Heterozygotes are WT.
|
|
EU769 |
C. elegans |
spn-4(or25) unc-42(e270) V/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and lay 10/16 dead eggs. spn-4 unc-42 homozygotes are Unc and lay dead embryos exhibiting defects in mitotic spindle orientation and cell fate patterning. spn-4(or25) homozygotes are non-conditional maternal effect embryonic lethal.
|
|
GS357 |
C. elegans |
unc-42(e270) arDf1 V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs and dead eggs. nT1 carries a dominant Unc mutation and a recessive lethal mutation. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
GS370 |
C. elegans |
evl-12(ar109)/dpy-11(e224) unc-42(e270) V. Show Description
Heterozygotes are WT and segregate WT, Steriles with an Everted Vul and DpyUncs. Received new stock 10/2003. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
GS384 |
C. elegans |
fos-1(ar105)/dpy-11(e224) unc-42(e270) V. Show Description
Heterozygotes are WT and segregate WT, Steriles with an Everted Vul and DpyUncs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. ar105 previously called evl-5(ar105).
|
|
GS776 |
C. elegans |
unc-32(e189) lin-12(n676n930) III; unc-42(e270) sel-11(ar39) V. Show Description
Unc. At 25C ar39 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. ar39 recessively suppresses vulval lineage defects and proximal mitosis. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JJ1014 |
C. elegans |
mex-3(zu155) dpy-5(e61)/hT1 I; pos-1(zu148) unc-42(e270)/hT1 V. Show Description
The double heterozygote is WT. WT will segregate WT, DpyUncs, mid-larval lethal (hT1 homozygotes) and dead eggs. The DpyUncs are homozygous for zu155 and zu148 and will segregate only dead embryos; the dead embryos have excess hypodermis and muscle and lack germ cells and intestine.
|
|
JJ462 |
C. elegans |
+/nT1 IV; pos-1(zu148) unc-42(e270)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Uncs, Vul and dead eggs. Uncs are homozygous for zu148 and will segregate only dead embryos; the dead embryos will have no morphogenesis and will lack germ cells and intestine.
|
|
JK2958 |
C. elegans |
nT1 [qIs51] (IV;V)/dpy-11(e224) unc-42(e270) V. Show Description
Segregates glowing heterozygotes and DpyUncs. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Crosses with this strain generate very few glowing hermaphrodite cross progeny and many glowing male cross progeny. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
KR1037 |
C. elegans |
unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270)] V. Show Description
Pick wild-type to maintain. Segregates wild-type, Dpy Unc, arrested hT1 homozygotes, and dead eggs. Reference: McKim KS, et al. Genetics. 1988 Dec;120(4):987-1001.
|
|
KR1054 |
C. elegans |
dpy-5(e61) unc-13(e450)/hT1 I; +/hT1 [unc-42(e270)] V. Show Description
Pick wild-type to maintain. Segregates wild-type, Dpy Unc, arrested hT1 homozygotes, and dead eggs. Reference: McKim KS, et al. Genetics. 1988 Dec;120(4):987-1001. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
KR1459 |
C. elegans |
dpy-5(e61) unc-13(e450)/hT1 [unc-29(e403)] I; +/hT1 [unc-42(e270)] V. Show Description
Pick wild-type to maintain. Segregates wild-type, Dpy Unc, arrested hT1 homozygotes, and dead eggs. Reference: McKim KS, et al. Genetics. 1988 Dec;120(4):987-1001.
|
|
MT1430 |
C. elegans |
unc-42(e270) egl-9(n586) V. Show Description
Egl Unc. n586 is a temperature sensitive allele.
|
|
MT1590 |
C. elegans |
egl-11(n587) unc-42(e270) V. Show Description
Temperature-sensitive Egl. Reference: Genetics (1983) 104:619-47.
|
|
MT2324 |
C. elegans |
unc-42(e270) egl-47(n1082) V. Show Description
Unc. Dominant Egl.
|
|
MT3773 |
C. elegans |
unc-42(e270) vab-8(e1017) V. Show Description
Unc. Posterior half thin and pale.
|
|
MT8999 |
C. elegans |
unc-42(e270) sqv-4(n2827) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Hets are Unc (n754) and segregate Unc (n754), Unc(e270)Sqv and dead eggs. n2827: mid-L4 vulva abnormal, sterile.
|
|
RG3055 |
C. elegans |
rpl-4(ve555[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous lethal, heterozygous animals might grow slower than wild-type. Deletion of 1188 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type mKate2+GFP+, and segregate wild-type mKate2+GFP+, arrested GFP+ non-mKate2 (rpl-4 homozygotes), arrested non-GFP mKate2+ (hT1 homozygotes), and dead eggs. Maintain by picking wild-type mKate2+ and GFP+. Left flanking Sequence: ATTTCTTCACGTTGGCCTTTGAAGCCTTGC ; Right flanking sequence: Ttattacctgcaatcaacagaaatagtaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3060 |
C. elegans |
vep-1(ve560[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. B0261.1. Homozygous Let. Deletion of 4055 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve560 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: AATGCACAATTTGCATCTCCAAATCCGCCA ; Right flanking sequence: ccgttattttacgactgtcaaatctccatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3067 |
C. elegans |
+/hT1 [umnIs58] I; erfa-1(ve567[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval arrest. Deletion of 2016 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve567 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: cagcacaaatagaatATGAGCGCTCCCGCA ; Right flanking sequence: GGTGGATGTTTCTACTCGCAATTCCAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|