Search Strains

Downregulation of tph-1::GFP expression in the ADF neurons. CORRECTION: The yz6 allele had been erroneously listed as y26 in our database.

Downregulation of tph-1::GFP expression in the ADF neurons.

lkIs2 [elp-1::GFP + lin-15(+)] IV. Relatively high levels of GFP expression as compared to KA41. Superficially wild-type. Maintain under normal conditions. Reference: Hueston JL, et al. BMC Dev Biol. 2008 Nov 17;8:110.

Triple mutant of the three spinster paralogs expressed exclusively in somatic tissues. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394.

Temperature sensitive. Maintain at 15C. Growth defect at 26.5C. Small body size. Slow nuclear accumulation of DAF-16 in response to hypoxia. Decreased lifespan in intermittent hypoxia. Incompletely penetrant defects in vulval and germline development. Reference: Pitt JN, et al. bioRxiv 2022.10.13.512140; doi: https://doi.org/10.1101/2022.10.13.512140

MT15501 mir-83(n4638) was outcrossed 6x to produce this strain. Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Combination mutant made with 6x outcrossed lines KB10 mir-67(n4899) and KB11 mir-83(n4638).

Temperature sensitive sterile at 26C, with EMO oocytes. Grows at 15C or 20C.

Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)]

ok98/+ animals are slightly Egl-d and have a small vulval bump. ok98 homozygotes are straight and paralyzed and slow growing. About 2/3 eventually reach adulthood and are paralyzed and sterile (they produce few if any oocytes). Segregates Unc Muv(ts).

ceIs259 [unc-129p::RFP::syn-13 + unc-129p::Venus + ttx-3p::RFP]; Inserted at center of LG IV. Expresses RFP::SYN-13 to mark early endosomes in a set of 9 DA/DB cholinergic motor neurons in the ventral nerve cord. unc-129::Venus fills the neuron and thus is useful for identifying regions and can also be used as a control for effects on expression of the transgene. Reference: Edwards SL, et al. Genetics. 2015 Sep;201(1):91-116. Edwards SL, et al. (manuscript in revision). "Sentryn Acts with a Subset of Active Zone Proteins in the Guided Transport and Capture of Synaptic Vesicles in Caenorhabditis elegans."

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP capg-2 homozygotes (sick, sterile, Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.

Wild type. Silent mutations GGGACAAAAT >TGGTCAGAAC position IV:10,127,238..10,127,252

Gain-of-function mutant. Hypersensitive to serotonin.

Thermotolerant.

Heterozygotes are WT and segregate WT, Bli Unc, and dead larva. vha-8(jh135) homozygotes are larval lethal.

Dpy. Twitcher.

Heterozygotes are Unc and segregate Unc, RolPar (adult homozygotes lay eggs that don't hatch) and dead eggs. nT1[unc-?(n754) let-?] is dominant Unc and recessive lethal. Strict maternal effect. sc8 previously called rol-4(sc8).

Heterozygotes are Unc and segregate Unc, Twitchers which give only dead eggs, and dead eggs. nT1 heterozygotes are shorter and slower than par-5 unc-22 homozygous worms. par-5 region is not well balanced by nT1: check to make sure that unc-22 homozygotes lay dead eggs. Strict maternal effect lethal.

Heterozygotes are Unc and segregate Uncs and dead eggs.

muIs32 [mec-7p::GFP + lin-15(+)]. Egl. Anterior migration of the QL.d, defects in QR.d and HSN migration.

muIs32 [mec-7p::GFP + lin-15(+)]. Egl. Anterior migration of the QL.d, defects in QR.d and HSN migration.

huIs60 [egl-20p::egl-20::protA + dpy-20(+)].

nuIs26 [cat-1::GFP] IV. nuIs26 contains a full length CAT-1::GFP fusion protein (with GFP fused at the predicted carboxy terminus of CAT-1). This transgene rescues the hyperactive locomotion defect of cat-1(e1111). This strain is slightly sluggish for locomotion and has a high degree of sterility (80%), both of which appear to be associated with the transgene. GFP expression in this strain is similar to the CAT expression pattern described by Duerr et al (1999) J Neurosci 19: 72-84.

Mutation confirmed by Nonet lab.

nuIs122 [acr-2p::pHluorin::snb-1 + myo-2p::dsRed2] IV. Integrated transgene expressing synaptopHluorin under a cholinergic promoter for imaging motor neuron synapses.

Enhanced RNAi. Temperature sensitive sterile at 25C. Grow at 15 to 20C.

Weak Osm as homozygote. Non-allelic non-complementor of osm-10(n1602).

sf1003 is a CRISPR-engineered deletion in aat-1. aat-1(sf1003) mutants show elevated pumping rates and enhanced learning capacity compared to well-fed wild type animals (similar to nkat-1 mutants). Reference: Lin L, et al. Genes Dev. 2020 Aug 1;34(15-16):1033-1038. doi: 10.1101/gad.339119.120. PMID: 32675325.

Stable and homozygous viable. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

C50F4.11. Strain segregates WT, Uncs (give Sterile progeny or progeny with reduced brood size, all of which arrest before hatching (24%), at various stages of larval development (55%), or later) and dead eggs. Rec'd new stock 11/2002. Attribution: Paper_evidence WBPaper00005604

ynIs40 [flp-11p::GFP] V. kasEx35 [unc-3p(558bp)::lin-39(cDNA) + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. kasEx35 produces over-expression of lin-39 specifically in cholinergic motor neurons, causing ectopic flp-11::GFP expression. Reference: Feng W, et al. "A terminal selector prevents a Hox transcriptional switch to safeguard motor neuron identity throughout life." bioRxiv (2019): 643320.

ynIs40 [flp-11p::GFP] V. kasEx39 [cho-1p(208bp)::lin-39(cDNA) + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. kasEx39 produces over-expression of lin-39 specifically in cholinergic motor neurons, causing ectopic flp-11::GFP expression. Reference: Feng W, et al. "A terminal selector prevents a Hox transcriptional switch to safeguard motor neuron identity throughout life." bioRxiv (2019): 643320.

syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.

Abnormal T cell lineages. Leptoderan male tail. Phasmid dye fill defective (due to T cell lineage defect).

Polarity mutant. 0% phasmid fill.

Sensitive to heavy metal stress.

Sensitive to heavy metal and oxidative stress.

Exc.

Unc. Maintain at 15C. Temperature-sensitive Emb when L4 larvae are shifted to restrictive temperature (25C). L1 larvae shifted to restrictive temperature arrest and die as young larvae. Reference: Bowman EA, et al. Worm Breeder's Gazette 2011 18(4).

Unc. Maintain at 15C. Temperature-sensitive Emb when L4 larvae are shifted to restrictive temperature (25C). L1 larvae shifted to restrictive temperature arrest and die as young larvae. Reference: Bowman EA, et al. Worm Breeder's Gazette 2011 18(4).

bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Resistant to germ cell apoptosis. No apoptosing germ cells are decorated by CED-1::GFP in the gonad. ced-3 deletion confirmed by genomic triple primer PCR with 5’-AGTTCACCGTGACAGCGTCTCTTC-3’, 5’-CGATTACGACTTGAACTGTATCCGA-3’, and 5’-TCTTGTGTAAACGAGATTTGCAATG-3’. Homozygous ced-3(n2452) yields only 1,110 bp product. Outcrossed heterozygotes yield both 1,411 bp (wild type ced-3) and 1,110 bp products. [NOTE: (11-05-2019) A user has reported this strain exhibits temperature-sensitive sterility when raised at 25C.]

Pvl. Egl. Weaker allele than pf88 and pf159.

Pvl. Egl. Poor mating.

uaDf5/+ is stable as a heterozygote. The strain does not appear to segregate live animals with uaDf5/uaDf5 or +/+ genotypes. Throws males.