Search Strains

ufIs126 [flp-13p::acr-12::GFP + lgc-11::mCherry] V. ACR-12::GFP expression labels postsynaptic iAChRs in DD motor neurons. References: Philbrook A, et al. eLife. 2018 Jul 24;7:e35692. doi: 10.7554/eLife.35692. PMID: 30039797. Oliver D, et al. PLoS Genet. 2022 Jan 28;18(1):e1010016. doi: 10.1371/journal.pgen.1010016. PMID: 35089924. Alexander K, et al. bioRxiv 2022.10.21.512874; doi: https://doi.org/10.1101/2022.10.21.512874.

mScarlet tag inserted into endogenous rack-1 locus. Ubiquitous mScarlet expression.

Resistant to 400ug/ml NaF. Slow growth. Small brood size. Small and thin.

Homozygous viable. Deletion of 2572 bp in parental strain N2. Left flanking sequence: atctatttttttaaggccgaac; Right flanking sequence: tattggcagcaagcgttgcgaa. sgRNA #1: ccatacgttgttgtggagtt; sgRNA #2: tgtgaagcggaaaaccctat.

Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta.

Homozygous sterile. Balanced by nT1[qIs51]. Deletion of 3471 bp in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa.

Temperature-sensitive. Grows well at 15C; embryonic lethal at 25C. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

3xFLAG tag inserted into the endogenous ints-6 locus. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

etIs1 [ric-19p::ric-19::GFP + rol-6(su1006)] IV. Temperature-sensitive. Maintain at 15-20C. 100% embryonic lethal at 25C. Pharynx unattached (Pun) and morphogenic defects. Reference: Zheleva A, et al. PLoS Genet. 2019 Sep 16;15(9):e1008338.

mScarlet::3xMyc tag inserted at the C-terminus of the endogenous spe-44 locus by CRISPR. Allele obtained using the self-excising cassette, following Dickinson et al, 2015 method. SEC was excised; there is a lox511I in the synthetic intron left by the excision. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.

mScarlet::TEV::AID*::3xFLAG tag inserted at the C-terminus of the endogenous spe-44 locus by CRISPR. Insertion includes a flexible 30 amino acid linker between SPE-44 and mScarlet and was produced by SEC excision. Strain contains a lox511I site in a synthetic intron. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 4 of the endogenous noah-2 locus by CRISPR. Insertion produces a translational fusion after amino acid 388. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous dpy-4 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-14 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous clec-180 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-125 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-103 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous col-125 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd300.

linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous col-103 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd301.

30x linker::mScarlet(dpi)::10x linker tag inserted into the C-terminus of the endogenous dpy-13 locus by CRISPR using a Cas9 RNP. Derived by modification of syb3318[dpy-13::mNG] in parental strain PHX3318, replacing mNeonGreen with the mScarlet and linkers.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-118 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

GFP::TEV::AID*::3xFLAG tag inserted at the C-terminus of the endogenous spe-44 locus by CRISPR. Insertion includes a flexible 30 amino acid linker between SPE-44 and GFP and was produced by SEC excision. Strain contains a lox511I site in a synthetic intron. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.

wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Endogenous dpy-27 locus tagged with AID* element and myc to create a conditional allele using the auxin-inducible degron (AID). In absence of auxin, ~40% of worms are male due to him-8(me4) mutation. In the presence of auxin, ~100% of worms are male (hermaphrodite-lethal due to degradation of AID-tagged DPY-27). Reference: Li Q, et al. Inducible degradation of dosage compensation protein DPY-27 facilitates isolation of Caenorhabditis elegans males for molecular and biochemical analyses. bioRxiv 2022.01.27.478040; doi: https://doi.org/10.1101/2022.01.27.478040.

Heterozygotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs. mbk-2(pk1427) is a deletion that removes most of the mbk-2 locus.

ltIs37 [(pAA64) pie-1p::mCherry::his-58 + unc-119(+)] IV. axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.

ltIs37 [(pAA64) pie-1p::mCherry::his-58 + unc-119(+)] IV. axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.

ddEx16 [pgl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. Maintain at 25C to retain transgene expression. Heterozygotes are Unc and segregate Uncs, dead eggs and WT. Reference: Wang JT, et al. eLife 2014;3:e04591.

Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

Maintain at 25C. Intragenic suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

Maintain at 25C. Intragenic suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

Maintain at 25C. Intragenic suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Formerly known as mat-2. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.

orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.