Search Strains

More Fields
Strain Species Genotype Add
DR1565 C. elegans daf-2(m596) III. Show Description
Class 2 allele of daf-2. Temperature sensitive Daf-c. Adults are long-lived (Age) and exhibit extrinsic thermotolerance (Itt).
DR1566 C. elegans daf-2(m579) III. Show Description
Adults Age and Itt and temperature sensitive Unc (class 2 allele). m579 results in an amino acid substitution(R437C) in the extracellular portion of the DAF-2 receptor (specifically, the Cys-rich domain).
DR1567 C. elegans daf-2(m577) III. Show Description
Class 1 allele of daf-2. Temperature sensitive Daf-c. Adults are long-lived (Age) and exhibit extrinsic thermotolerance (Itt).
DR1568 C. elegans daf-2(e1371) III. Show Description
Class 1 allele of daf-2. Temperature sensitive Daf-c. Maintain at 15C. Adults are long-lived (Age) and exhibit extrinsic thermotolerance (Itt).
DR1572 C. elegans daf-2(e1368) III. Show Description
Maintain at 15C.  Class 1 allele of daf-2. Temperature sensitive Daf-c. Adults are long-lived (Age) and exhibit extrinsic thermotolerance (Itt).
DR1574 C. elegans daf-2(e1391) III. Show Description
Class 2 allele of daf-2. Temperature sensitive Daf-c. Adults are long-lived (Age) and exhibit extrinsic thermotolerance (Itt). Produces some dauers at 15C. CGC received new stock 10/25/00 from David Gems. Received new stock from Patrice Albert in the Riddle lab 6/04.
DR1690 C. briggsae C. briggsae. Show Description
Previously called C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years and carrues a 33-kilobase deletion that disrupts one of the srg paralogs, CBG24690, and six other genes. It is Unc, dauer-defective and ts lethal. Reference: McGrath PT, et al. Nature. 2011 Aug 17;477(7364):321-5.
DR1786 C. elegans dpy-13(e184) unc-24(e138) IV; mDp4[unc-17(e245)] (IV;?). Show Description
WT phenotype. Segregates WT and DpyUncs. mDp4 carries dpy-13(+) and unc-24(+). Duplication may recombine with normal homologues. Presence of unc-17(e245) on mDp4 confirmed: got Unc-17 segregants after heat shock of this stock to generate males. Pick WT and check for segregation of progeny to maintain.
DR1790 C. elegans rol-1(e91)/mT1 II; unc-71(e541)/mT1 [dpy-10(e128)] III. Show Description
Heterozygotes are WT and segregate WT, Roller Uncs, and a few Dpy mT1 homozygotes. mT1 is an apparent II;III translocation: small broods, lots of dead eggs, and exhibits pseudolinkage between rol-1 II and unc-71 III. The Roller phenotype of rol-1 expresses late and cannot be scored before adulthood. Pick non-Unc hermaphrodites and check for correct segregation of progeny.
DR1809 C. elegans unc-4(e120)/mIn1 [dpy-10(e128) let-?(m727)] II. Show Description
Heterozygotes are WT and segregate WT, unc-4, and lethal mIn1 homozygotes. Pick WT and check for correct segregation of progeny.
DR1832 C. elegans mT1/unc-4(e120) II; mT1 [dpy-10(e128)]/dpy-17(e164) III. Show Description
WT phenotype. Segregates WT, sterile Dpy mT1 homozygotes, Unc-4;Dpy-17 and large numbers of arrested aneuploid embryos. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
DR1942 C. elegans daf-2(e979) III. Show Description
This strain forms 20% dauers at 15C. At 25C there occurs about 25% embryonic arrest and about 75% L1 arrest. The e979 mutation results in an amino acid substitution, C146Y, in the ligand-binding domain of the DAF-2 receptor. [CGC received new stock of DR1942 September 2002. Previous stock was probably m41 and not e979.] [June 2004: Patrice Albert has confirmed the mutation in this stock: Repeat of sequencing for CGC collection strain DR1942 [daf-2(e979)] is complete. The strain does carry a C146Y mutation (coding strand TGC to TAC) [Mutation position is at 143, not 146, based on the amino acid sequence shown in Wormbase for daf-2. It's the C in partial sequence EKRCGPI of Exon 5.].]
DR2054 C. elegans mIn1 [unc-4(e120) dpy-10(e128)]/let-552(e2542) rol-1(e91) II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc [mIn1(mc6) homozygotes], and two-fold arrest Let Rol progeny. Well balanced. Male stock. Cross WT males to WT hermaphrodites and check for correct segregation of progeny.
DR2055 C. elegans mIn1(+) II. Show Description
Dark-bodied, unmarked variant of mIn19mC6) with small broods. Presumably balances let-552 to rol-1 (hermaphrodite stock obtained from outcrossing these males to dpy-10 unc-4 was shown to balance this interval). Isolated from DR1982 as a stock that no longer segregated Dpy-10 animals. Not clear whether this strain is the result of chromosome rearrangement in DR1982, or if DR1982 stock was a mixture of mIn1(+)/mIn[dpy-10] and mIn1(+) homozygotes.
DR2075 C. elegans mIn1 [unc-4(e120)]/let-552(e2542) rol-1(e91) II. Show Description
Heterozygotes are WT and segregate WT, Lethal Rollers (arrested 2-fold hatchlings), and Unc-4 mIn1(mC6) homozygotes. Pick WT and check for correct segregation of progeny.
DR2078 C. elegans mIn1 [dpy-10(e128) mIs14]/bli-2(e768) unc-4(e120) II. Show Description
WT gross phenotype, with GFP semi-dominantly expressed in 4-60 cell embyros, pharyngeal muscle and gut. Segregates WT, brighter Dpy GFP mIn1 homozygotes and non-GFP bli-2 unc-4 homozygotes. Pharyngeal and gut GFP is easily seen in a UV dissecting microscope; early embryonic signal requires higher magnification. mIs14 occasionally crosses off mIn1[dpy-10], apparently by double recombination. Pick WT, check for GFP and check for correct segregation of progeny to maintain. mIs14 is ccEx9747 integrated into mIn1[dpy-10]. This is a three-construct element containing myo-2 and pes-10 promoters and a gut enhancer fused individually to GFP coding sequence.
DR2102 C. elegans mIn1 [rol-1(e91)]/let-552(e2542) unc-4(e120) II. Show Description
Heterozygotes are WT and segregate WT, Lethal Uncs and Roller mIn1 homozygotes. let-552 unc-4 chromosome is well balanced. Rol does not express until late L4/early adult. Pick WT and check for correct segregation of progeny.
DR25 C. elegans daf-12(m25) X. Show Description
Dauer defective. Class 2 suppressor of dauer constitutives. Chemotaxis normal. See also WBPaper00002149. [Previously called daf-20.]
DR27 C. elegans daf-16(m27) I. Show Description
Dauer defective. Chemotaxis normal. Class 2 suppressor of dauer constitutive.
DR373 C. elegans unc-15(e73) I; sus-1(m156) III; eDp23 V. Show Description
Paralyzed Unc. sus-1 suppresses the ability of eDp23 to suppress unc-15. eDp23 = sup-3(e1407).
DR608 C. elegans daf-2(m212) III. Show Description
Temperature sensitive Daf-c. Maintain at 15C. Adults Age and Itt, but not Unc (severe class 1 allele). m212 results in an amino acid substitution(C883Y) in the extracellular portion of the DAF-2 receptor (specificaly, the FnIII2ID domain).
DR629 C. elegans unc-15(e73) I; sus-1(m156) daf-2(e1370) III; eDp23 V. Show Description
Temperature sensitive dauers. Paralyzed Unc. sus-1 suppresses the ability of eDp23 to suppress unc-15. eDp23 = sup-3(e1407).
DR722 C. elegans age-1(m333)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
WT phenotype, segregates WT, Egl (age-1 homozygotes) and DpyUncs. Egl animals give all non-recovering dauer larvae (m333 shows maternal effect), with variable radial shrinkage and variable resistance to 1% SDS. Pick WT to maintain and check for correction segregation of progeny. age-1(m333) pka daf-23(m333).
DR848 C. elegans daf-8(e1393) unc-29(e1072) I. Show Description
Unc-weak kinker, doesn't back well. Temperature sensitive dauer constitutive. Maintain at 15C. Makes high percentage of dauers at 25C. tsp for dauer formation is L1 molt. Type C Egl. Active. Resistant to 1 mM levamisole. Sensitive to hypoosmotic shock.
DR966 C. elegans dpy-13(e184) ama-1(+) IV. Show Description
Dpy. Sensitive to alpha-amanitin. [NOTE: formerly described as ama-1(m118m370m414), it has been determined that m414 was reversion of m367 back to wild-type sequence.] Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DUP223 C. elegans glh-1(sam129[glh-1::T2A::sGFP2(1-10)]) I. Show Description
T2A::sGFP2(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates sGFP2(1-10) from GLH-1 post-translationally so that sGFP2(1-10) disperses throughout germ cell nuclei and cytoplasm. sGFP2(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Proteins tagged with the 16aa GFP11 or M3 sequence will bind sGFP2(1-10) in the germline and early embryo to emit GFP fluorescence. Broods from DUP223 are similar to wild-type at permissive and restrictive temperatures. Transgene tag was inserted by CRISPR/Cas9 in an N2 background. [NOTE: (04/23/2021) The original stock received by the CGC was found to be carrying a second insertion, clu-1(sam131[GFP(11)::clu-1]. A new stock verified by to be carrying the correct transgene was received from DUP 05/04/2021.] Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
DUP237 C. elegans glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I. Show Description
T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Proteins tagged with the 18aa wrmScarlet(11) sequence will bind wrmScarlet(1-10) in the germline and early embryo to emit wrmScarlet fluorescence. Broods from DUP237 are similar to wild-type at permissive and restrictive temperatures. Transgene tag was inserted by CRISPR/Cas9 in an N2 background. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
DV2208 C. elegans unc-97(su110) X. Show Description
Made by outcrossing HE110 four times. su110 is moderately Smg suppressible: HE110 animals are significantly less Unc than DV2208, and HE110 animal are also pVul, which is characteristic of Smg mutations.
DV2689 C. elegans sec-5(pk2357)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes segregate wild-type GFP+ heterozygotes, GFP+ Dpy, and sec-5 homozygotes (scrawny, small broods, abnormal gut appearance) sec-5 is homozygous maternal-effect lethal; M+Z- animals produce a few dead L1-L2 stage larvae with Vab defects. Pick GFP+ wild-type to maintain. Based upon phenotype, pk2357 is a strong loss-of-function, but likely not a null allele; molecular lesion produces a premature stop at position 389. Reference: Frische EW, et al. EMBO J. 2007 Dec 12;26(24):5083-92. [NOTE: This strain was previously described as carrying pk2358, but pk2357 is the correct allele. Both pk2357 and pk2358 cause the same nonsense (amber) change.]
DV3089 C. elegans rheb-1(re64[mKate2::3xFlag::rheb-1]) III. Show Description
mKate tag inserted at 5' end of endogenous rheb-1 locus. Ubiquitous expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. Reference: Duong T, et al. Development. 2020 Mar 2;147(5):dev181727. doi: 10.1242/dev.181727. PMID: 32041790.
DV3208 C. elegans daf-15(re147[daf-15::mNG::2xHA]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.
DV3285 C. elegans his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
DV3313 C. elegans rap-1(re180) IV. Show Description
Gain-of-function allele (G12V). Low penetrance of 3? to 1? fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.
DV3327 C. elegans pmk-1(re170[pmk-1::mNG::3xFlag]) IV. Show Description
mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
DV3525 C. elegans daf-15(re257[daf-15::mNG::AID*]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus; AID* at 3' end of mNeonGreen. Ubiquitous expression. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin.
DV3670 C. elegans rheb-1(re64 re285[AID*::mKate2::3xFlag::rheb-1]) III. Show Description
AID* tag in 5' end of mKate2-tagged endogenous rheb-1. Ubiquitous mKate2 expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. universal mKate2 site crRNA: catgttttctttaatgagct / insertion site in mKate2:gaagATGCCA....GGAGCATCGGGAGCCTCAGGAGCATCGATGGTCTCCGAGC^TCATTAAAGA. Reference: Fakieh R, et al. MicroPubl Biol. 2022 Aug 9:2022:10.17912/micropub.biology.000622. doi: 10.17912/micropub.biology.000622. PMID: 36035777.
DV3765 C. elegans scd-1(re305[scd-1::mKate2::2xHA]) X. Show Description
mKate GLO (germline optimized) tag inserted at C-terminus of endogenous SCD-1. Red fluorescence in all nuclei. Cas9 guide + PAM: GACTTGGAAGAAGACGGTGG+AGG. Reference: Ailion M, et al. In preparation.
DV3799 C. elegans reSi1 I. Show Description
reSi1 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei.
DV3800 C. elegans reSi2 II. Show Description
reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei.
DV3801 C. elegans reSi3 I. Show Description
reSi3 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
DV3803 C. elegans reSi5 I. Show Description
reSi5 [ges-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Intestinal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in intestinal nuclei.
DV3805 C. elegans reSi7 I. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
DV3825 C. elegans reSi11 II. Show Description
reSi11 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
DV3826 C. elegans reSi12 II. Show Description
reSi12 [ges-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Intestinal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in intestinal nuclei.
DV4326 C. elegans bar-1(ga80) X. Show Description
Variably penetrant Unc, Vul, pVul, Egl, vulval rupture, and slow growth. Parental strain EW15 was outcrossed to separate bar-1(ga80) from a described background PRY-1(N354K) mutation. The phenotypes of the outcrossed strain are much more severe than those of the progenitor strain EW15.
DW101 C. elegans atl-1(tm853) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Heterozygotes are Unc and GFP+ with signal in the pharynx. atl-1(tm853) homozygotes are non-Unc, viable, GFP-, and produce 100% dead embryos. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine. nT1[unc-?(n754) let-? qIs50] is also known as DnT1[qIs50]. qIs50 is apparently inserted on DnT1. qIs50 is somewhat dimmer than the similar qIs51.
DW104 C. elegans brc-2(tm1086) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
tm1086 is homozygous lethal. Maternally rescued. Fails to produce viable progeny due to a defect in repairing meiotic DNA double-strand breaks. Chromosomes are visibly aggregated at diakinesis. Maintain by picking GFP progeny and checking that the non-GFP progeny that are produced fail to give viable progeny. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
DWF1108 Acrobeloides sp. Show Description
Originally from ecological study at University of GA. Identification by E. Mae Noffsinger.
DWF1109 Acrobeloides thornei Show Description
Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. [6/98: Paul De Ley has checked this strain and suggests that it doesn't match the original description of Acrobeloides thornei very well.]
DWP219 C. elegans daam-1(ups39) V. Show Description
Superficially wild-type. ups39 is a CRISPR-engineered deletion within daam-1. daam-1(ups39) encodes an in-frame stop codon near the start of its FH2-coding sequence, and a 1-nt frame shift due to the LoxP site, and is thus predicted encode a non-functional formin. Reference: Sundaramurthy S, et al. Cytoskeleton (Hoboken). 2020 Oct;77(10):422-441. doi: 10.1002/cm.21639. PMID: 33103378.