XX animals have no obvious phenotype: self-fertile with normal brood size. XO animals are self-fertile hermaphrodites with low brood size and some somatic gonad defects. Cbr-fem-2/+ XO animals show late-onset germline feminization. AF16 was the parental strain.

XX are self-fertile hermaphrodites.

Dauer defective. Dpy.

Dauer defective. Chemotaxis normal. Class 2 suppressor of dauer constitutive.

Dorsal protrusions on head and tail. Head frequently twisted. 30% of embryos die. 86% of larvae die. 44% of adult survivors show a mutant phenotype. Full zygotic and maternal rescue.

Unc and Lon. ME2-3.

RNAi deficient.

sprSi19 [mex-5p::MODC PEST::GFP::H2B::set-6 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.

Homozygous lethal allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP syp-4(tm2713) homozygotes (viable but throw 97% dead eggs, 40% males). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smolikove S, et al. (2009) PLoS Genet 5(10):e1000669.

70% reduction of behavioral quiescence during sleep. Reference: Turek et al. eLife 2016;5:e12499.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10286 [nob-1::GFP::unc-54 3'UTR + rol-6(su1006)]. stIs10286 contains 9kb promoter and full nob-1 transcript fused to GFP. Reference: Zhao Z, et al. PLoS Genet. 2010 Sep 2;6(9):e1001089.

Aex and aldicarb resistant.

Superficially wild-type. Maintain under normal conditions. Reference: Deke SL, et al., J Neurosci. 2005 Jun 22;25(25):5975-83.

Cosmid coordinates (with respect to T23G5): 24967-26802 (or 24965-26800, or 24966-26801, or 24968-26803, or 24969-26804 - note that each deletion endpoint lies within a TATA sequence so there is some ambiguity in the precise endpoints). Flanking sequences: CTATTCGGATATCTTGCCAATGCTA//TAGGAATTATTTTTGCGCTCTCAGG. Deletion size: 1836 bp.

Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.

Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.

Superficially similar to unc-25 mutants (Shrinker, Exp, etc.). GABA-dependent phenotypes are rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30. Peden AS, et al. Nat Neurosci. 2013 Dec;16(12):1794-801.

Superficially the same as unc-25 mutants (Shrinker, Exp, etc.). Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 and unc-25; snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.

Superficially wild-type. Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.

Knock-out allele ok237 is a large (2229-bp) deletion. Coordinates: leftmost deleted base = 35441 of K02G10; rightmost deleted base = 296 of F55D10. ok237 eliminates almost all of K02G10.8 (dnj-14) and also the 5'-part of F55D10.3 (glit-1, encodes a homolog of gliotactin), as well as the presumed promoter regions between the 2 genes. In addition, F55D10.3 could be the first member of an operon, with F55D10.2 (aka rpl25.1, which encodes a ribosomal protein) as the second member of the operon. The deletion is likely to eliminate the expression of 2 or 3 genes, not just dnj-14.

Superficially wild-type. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.

Superficially wild-type. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.

Superficially wild-type. ok2267 removes bases +114 to 1751 relative to the start of the trxr-2 coding sequence. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.

neSi14 [FLAG::prg-1 + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.

neSi15 [FLAG::prg-1(D583A) + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.