More Fields
Strain Species Genotype
BA811 C. elegans sDf5/spe-4(hc78) unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT heterozygotes, Sterile Unc spe-4 unc-15 homozygotes, and dead eggs (sDf5 homozygotes). Pick wild-type to maintain.
BC110 C. elegans dpy-14(e188) unc-13(e51) let-85(s142)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, Unc and DpyUncLets. Lethal at L1. Maintain by picking WT.
BC112 C. elegans dpy-14(e188) unc-13(e51) let-82(s85)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc, and DpyUncLet (DpyUnc Larvae are abnormal). Maintain by picking WT.
BC115 C. elegans dpy-14(e188) unc-13(e51) let-81(s88)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncLets are abnormal larvae and die in early larval development. Pick WT to maintain.
BC123 C. elegans dpy-14(e188) unc-13(e51) let-84(s91)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLet. The DpyUncs are abnormal larvae that die in late larval development. Pick WT to maintain.
BC124 C. elegans dpy-14(e188) unc-13(e51) unc-37(s80)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLet. The DpyUncLet larvae are abnormal. Pick WT to maintain.
BC125 C. elegans dpy-14(e188) unc-13(e51) let-79(s81)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae that die in early larval development. Pick WT to maintain. Note 5/92: probably has lost dpy-14.
BC148 C. elegans dpy-14(e188) let-75(s101) unc-13(e51)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae that die in early larval development (L1). Pick WT to maintain. Previously called myo-1(s101).
BC149 C. elegans dpy-14(e188) unc-13(e51) let-83(s97)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUnc are abnormal larvae which die in early larval development. Pick WT to maintain.
BC157 C. elegans dpy-14(e188) unc-13(e51) let-80(s96)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and Lethal DpyUncs. Lethal early larval. Pick WT to maintain.
BC160 C. elegans dpy-14(e188) unc-13(e51) let-87(s106)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. Lethal early larval (L1). Maintain by picking WT.
BC162 C. elegans dpy-14(e188) unc-13(e51) let-88(s132)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae which die in early larval development. Pick WT to maintain.
BC165 C. elegans dpy-14(e188) unc-13(e51) let-89(s133)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. Lethal early larval. Maintain by picking WT.
BC184 C. elegans dpy-14(e188) unc-13(e51) bli-4(s90)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in late larval development. Pick WT to maintain. s90 previously called let-77. See also WBPaper00003507. CGC received new stock 3/01.
BC199 C. elegans sDf6/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, Paralyzed Unc and Lethals (L1). Pick WT to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC215 C. elegans dpy-14(e188) unc-13(e51) let-78(s82)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in late larval development. Pick WT to maintain.
BC220 C. elegans dpy-14(e188) unc-13(e51) let-90(s140)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae. Pick WT to maintain.
BC244 C. elegans dpy-14(e188) let-86(s141) unc-13(e51)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in early larval development. Pick WT to maintain.
BC455 C. elegans unc-15(e73) unc-13(e51) I. Show Description
Paralysed Unc.
BC694 C. elegans sDf5/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, Uncs and L1 lethals. Pick WT to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
CB2213 C. elegans unc-15(e73) I; eDp22 V. Show Description
Movement slow. Unc partially suppressed.
CB2220 C. elegans unc-15(e73) I; eDp23 V. Show Description
Movement almost WT. Unc suppressed.
CB2621 C. elegans unc-15(e73) I; eDf1 eDp21/sma-1(e30) V. Show Description
Heterozygotes are slow moving. Segregates paralysed small. eDf1 eDp21 homozygotes die in larval development.
CB73 C. elegans unc-15(e73) I. Show Description
Paralyzed Unc. Semi-dominant. M-MATING-NO SUCCESS.
DR115 C. elegans unc-15(e73) unc-54(e675) I. Show Description
Slow movement.
DR116 C. elegans unc-15(e73) I; sma-1(e30) V. Show Description
Small. Unc.
DR117 C. elegans unc-15(e73) I; dpy-11(e224) V. Show Description
Dpy. Unc. Very slow movement.
DR118 C. elegans unc-15(e73) I; dpy-11(e224) eDp22 V. Show Description
DR373 C. elegans unc-15(e73) I; sus-1(m156) III; eDp23 V. Show Description
Paralyzed Unc. sus-1 suppresses the ability of eDp23 to suppress unc-15. eDp23 = sup-3(e1407).
DR401 C. elegans unc-15(e73) I; eDf1 eDp21/dpy-11(e224) V. Show Description
Heterozygotes are slow moving. Hets segregate DpyUncs. Hets segregate larval lethals (eDf1 eDp21 homozygotes).
DR429 C. elegans dpy-5(e61) unc-15(e73) I. Show Description
Dpy. Unc. Semi-paralyzed.
DR605 C. elegans unc-15(e73) I; sup-19(m210) V. Show Description
Unc phenotype weakly suppressed. Very slow.
DR629 C. elegans unc-15(e73) I; sus-1(m156) daf-2(e1370) III; eDp23 V. Show Description
Temperature sensitive dauers. Paralyzed Unc. sus-1 suppresses the ability of eDp23 to suppress unc-15. eDp23 = sup-3(e1407).
DR632 C. elegans unc-15(e73) I; sus-1(m156) III. Show Description
Severly ill and paralyzed. Lays few eggs. More severe than unc-15 alone.
EM62 C. elegans mab-17(e2167) unc-15(e73) I; him-5(e1490) V. Show Description
Unc. Round bulging adult male tale. Very reduced fan. Mating efficiency is zero.
STE73 C. elegans nhr-80(tm1011) III; nhr-13(gk796) V. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
LE732 C. elegans lqIs27 IV; lin-15B&lin-15A(n765) X. Show Description
lqIs27 [ceh-23::GFP + lin-15(+)].
PHX3311 C. elegans casy-1(syb3311[casy-1::gfp11x7]) II. Show Description
Split-GFP tag inserted into endogenous casy-1 locus by SunyBiotech using CRISPR/Cas9 with two guide RNAs simultaneously. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
RG3230 C. elegans hum-6(ve730[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 10872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAGTATATTTTCTCAGGGTGACTTCATCTG ; Right flanking sequence: ttttGCAGAGTGTCAGGCGCGTGAATTAGG. sgRNA #11: aaaaGATAAACTCACGACAG; sgRNA #21: GATTGAGCCCGGAAAAACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3231 C. elegans hum-8(ve731[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 11054 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCTTCCGATATTTCTGCTCCTCTTTTACCG ; Right flanking sequence: TGGAATTGTTTTCGGCTCAAATGTCCCAAT. sgRNA #51: CTACAGGAGACGCTTCTTGT; sgRNA #6: TTAGGATCCACAATGTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3234 C. elegans snrp-200(ve734[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 9661 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve734 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttgaaaagaataataataataatacaaata ; Right flanking sequence: aggttaaaaaaatcaaaacaagaaataaaa. sgRNA #3: gaccagggagtgggtgacgg; sgRNA #4: GAATCCAGCAGTATGAGTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3237 C. elegans ZK265.7(ve737[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 6749 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cgtttgtctccttttctccaagccccgccc ; Right flanking sequence: ACTGGTAGCACTTCCCTTCTCGTTTCTGTA. sgRNA #3: tgagctgtctcacaagtggg; sgRNA #4: AGTGATTTTGAAAACTCTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3238 C. elegans msp-59(ve738[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 722 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: attggaaggtggcctccacctccaccaaat ; Right flanking sequence: tccccctatcgataaacttcaacactacaa. sgRNA #1: attcaaaagcgtatcaaatt; sgRNA #2: ggcatttcatgtgaattaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3239 C. elegans ZK858.7(ve739[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous lethal. Deletion of 2453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 lethals(lethal mid-larval to adult) (ve739 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation in hT2 is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: catattattaaattttaagtgtaaaagatt ; Right flanking sequence: aggcaacagagaacgaacgataaagtagtc. sgRNA #1: gaggaaatatgcaatttact; sgRNA #2: atcgacgagacggctacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
XE2260 C. elegans casy-1(wp78) II. Show Description
wp78 is a CRISPR/Cas9-engineered 11.5 kb deletion removing the entire coding region of casy-1, the C. elegans homolog of calsyntenin. casy-1(wp78) phenocopies the casy-1(wp60) point mutation and strongly suppresses PVQ degeneration in both ric-7(n2657) and miro-1(wy50180); mtx-2(wy50266) mutants. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.