More Fields
Strain Species Genotype
FAS46 C. elegans his-72 (uge30[gfp::his-72]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FX2066 C. elegans his-72(tm2066) III. Show Description
Homozygous viable and fertile. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
DV3285 C. elegans his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
FAS43 C. elegans his-69&his-70(uge44) his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X. Show Description
Deletion of all genes coding H3.3 histone variant. Superficially wild-type with slight reduction of brood size at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
RW10006 C. elegans unc-119(ed3) ruIs32 III; zuIs178 V. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. Ubiquitous histone-GFP fusion protein in embryo and adult germline as well as many adult somatic cells.
AML470 C. elegans juSi164 unc-119(ed3) III; wtfIs458. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs458 [mec-4::Chrimson4.2::SL2::mCherry::unc-54 3' UTR + unc-122::GFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Transgenic animals express light-gated ion channel Chrimson and a fluorescent protein mCherry in mechanosensory neurons alongside GFP in coelomocytes.
CZ20310 C. elegans juSi164 unc-119(ed3) III. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. Maintain in the covered box to avoid unnecessary exposure to ambient light. Wild-type behavior in movement, mating, growth and brood size. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Wild-type behavior in movement, mating, growth and brood size. MosSCI insertion into oxTi444 on Chr. III. Reference: Noma K & Jin Y. Nature Communications, 2015.
DZ841 C. elegans tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
GLW27 C. elegans muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
JJ1850 C. elegans unc-119(ed3) III; zuIs178. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. HIS-72::GFP can be detected in germline and most somatic nuclei, but not in intestinal nuclei. Not integrated on X.
JJ1851 C. elegans unc-119(ed3) III; zuEx181. Show Description
zuEx181[his-72(1kb 5' UTR)::YFP::GSRPVAT::HIS-72::HIS-72 (1KB 3'UTR) + 5.7 kb XbaI - HindIII UNC-119(+)]. HIS-72::YFP signal can be detected in the germline and most somatic nuclei, but not in intestinal nuclei.
JJ2059 C. elegans unc-119(ed3) III; zuIs235. Show Description
zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
JJ2060 C. elegans unc-119(ed3) III; zuIs236. Show Description
zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
JJ2061 C. elegans unc-119(ed3) III; zuIs235; zuIs236. Show Description
zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
JJ2281 C. elegans unc-119(ed3) III; zuIs258. Show Description
zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
JJ2300 C. elegans unc-119(ed3) III; zuIs258; zuIs263. Show Description
zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
RW10007 C. elegans pha-1(e2123) stIs10007 III; zuIs178 V. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10007 [pha-4 (4.1kb)) H3::H3::GFP::H3 3'UTR + pie-1p::H2B::GFP::pie-1 3'UTR + pha-4p::H1::DsRed::T1::let-858 3'UTR]. May still contain ruIs32 [pie-1::H2B-GFP + unc-119(+)] in the background.
RW10026 C. elegans unc-119(ed3) III; stIs10026. Show Description
stIs10026 [his-72::GFP::his-72 3' UTR full length translation fusion + unc-119(+)].
RW10029 C. elegans zuIs178; stIs10024. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. May still have unc-119(ed3) in the background.
RW10048 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10044. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10044 [mir-57::HIS-24::mCherry + unc-119(+)].
RW10060 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10060. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10060 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)].
RW10062 C. elegans unc-119(ed3) III; zuIs178 V; stIs10050. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10050 [pha-4(4kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10064 C. elegans unc-119(ed3) III; zuIs178 V; stIs10064. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10064 [end-3::H1-wCherry::let-858 3' UTR + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10083 C. elegans unc-119(ed3) III; zuIs178 V; stIs10059. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10059 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10084 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10039. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10039 [mir-61::H1.1-GFP::let-858 3' UTR + unc-119(+)].
RW10097 C. elegans unc-119(ed3) III; zuIs178 V; stIs10088. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10088 [hlh-1(3.3kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
RW10098 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10035. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10035 [eft-3-L2::H1-wCherry + unc-119(+)].
RW10108 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10086. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10086 [ges-1::H1-wCherry + unc-119(+)].
RW10112 C. elegans unc-119(ed3) III; stIs10026; stIs10089. Show Description
stIs10026 [his-72(1kb)::HIS-72::GFP + unc-119(+)]. stIs10089 [hlh-1(3.3kb)::HIS-24::mCherry + unc-119(+)].
RW10131 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10131. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10131 [elt-7::H1-wCherry + unc-119(+)].
RW10166 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10157. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10157 [dpy-7::H1-wCherry + unc-119(+)].
RW10174 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10174. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10174 [pal-1::H1-wCherry + unc-119(+)].
RW10175 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10138. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10138 [tbx-38::H1-wCherry + unc-119(+)].
RW10177 C. elegans unc-119(ed3) III; zuIs178; stIs10177. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10177 [cwn-1::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10196 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10122. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10122 [hnd-1::MycCherry I (modENCODE39) + unc-119(+)].
RW10197 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10137. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10137 [med-2::H1-wCherry + unc-119(+)].
RW10199 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10140. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10140 [vab-7::H1-wCherry + unc-119(+)].
RW10206 C. elegans unc-119(ed3) III; zuIs178; stIs10308. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10308 [die-1::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10230 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10224. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10224 [lin-39::H1-wCherry + unc-119(+)].
RW10234 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10220. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10220 [end-1::H1-wCherry + unc-119(+)].
RW10238 C. elegans unc-119(ed3) III; zuIs178; stIs10190. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10190 [C08B11.3::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10249 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10218. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10218 [tbx-11::H1-wCherry + unc-119(+)].
RW10265 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10143. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10143 [tbx-8::H1-wCherry + unc-119(+)].
RW10345 C. elegans unc-119(ed3) III; zuIs178; stIs10322. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10322 [ceh-43::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10346 C. elegans unc-119(ed3) III; zuIs178; stIs10323. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10323 [elt-1::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
RW10348 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10318. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10318 [nhr-25::TGF(3H4)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10349 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10311. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10311 [lin-39::TGF(3D3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10350 C. elegans unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10309. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10309 [mab-5::TY1::eGFP::3xFLAG(P000007_E01)]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
RW10371 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10335. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10335 [sdz-28::H1-wCherry + unc-119(+)].
RW10375 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10340. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10340 [tbx-9::H1-wCherry + unc-119(+)].