| FAS46 |
C. elegans |
his-72 (uge30[gfp::his-72]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
| FX2066 |
C. elegans |
his-72(tm2066) III. Show Description
Homozygous viable and fertile. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| DV3285 |
C. elegans |
his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background.
C-terminally tagged mpk-1 is detectable by triplex PCR:
mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG
mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC
mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC
Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
|
|
| FAS43 |
C. elegans |
his-69&his-70(uge44) his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X. Show Description
Deletion of all genes coding H3.3 histone variant. Superficially wild-type with slight reduction of brood size at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
| RW10006 |
C. elegans |
unc-119(ed3) ruIs32 III; zuIs178 V. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. Ubiquitous histone-GFP fusion protein in embryo and adult germline as well as many adult somatic cells.
|
|
| AML344 |
C. elegans |
juSi164 unc-119(ed3) III; wtfIs263. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs263 [rab-3p::AI::ChR2(H134R)::unc-54 3'UTR + rab-3p::AI::Voltron::unc-54 3'UTR + rab-3p::his-24::tagBFP::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of ChR2 (H134R) along with Voltron volatage indicator and nuclear-localized tagBFP. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
|
|
| AML376 |
C. elegans |
juSi164 unc-119(ed3) III; wtfEx296. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx296 [rab-3p::AI::gur-3G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Pick RFP+ to maintain. Keep plates covered to avoid unnecessary exposure to light. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
|
|
| AML405 |
C. elegans |
juSi164 unc-119(ed3) III; wtfEx315. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx315 [5xQUAS::(delta)pes-10P::AI::gur-3G::unc-54 3'UTR + 5xQUAS::(delta)pes-10P::AI::prdx-2G::unc-54 3'UTR + rab-3p::AI::QF+hGR::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
|
|
| AML438 |
C. elegans |
juSi164 unc-119(ed3) III; wtfIs335. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs335 [5xQUAS+(delta)pes-10p::AI::eTsChR::unc-54 3'UTR + rab-3p::AI::QF+hGR::SL2::tagBFP::unc-54 3'UTR + rab-3p::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal eTsChR on activation using dex treatment via QF+hGR. Worms also express calcium sensing fluorescence protein- GCaMP6s in nuclei of each neurons. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
|
|
| AML470 |
C. elegans |
juSi164 unc-119(ed3) III; wtfIs458. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs458 [mec-4::Chrimson4.2::SL2::mCherry::unc-54 3' UTR + unc-122::GFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Transgenic animals express light-gated ion channel Chrimson and a fluorescent protein mCherry in mechanosensory neurons alongside GFP in coelomocytes. Reference: Liu M, et al. PLoS Biol. 2022 Jan 28;20(1):e3001524. doi: 10.1371/journal.pbio.3001524. PMID: 35089912.
|
|
| AML540 |
C. elegans |
juSi164 unc-119(ed3) III; wtfIs483. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs483 [rab-3p::AI::lite-1G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of a purple/violet light-sensitive optogenetic protein system LITE-1 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
|
|
| CZ20310 |
C. elegans |
juSi164 unc-119(ed3) III. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. Maintain in the covered box to avoid unnecessary exposure to ambient light. Wild-type behavior in movement, mating, growth and brood size. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Wild-type behavior in movement, mating, growth and brood size. MosSCI insertion into oxTi444 on Chr. III. Reference: Noma K & Jin Y. Nature Communications, 2015.
|
|
| DZ841 |
C. elegans |
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
|
|
| GLW27 |
C. elegans |
muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
|
|
| JJ1850 |
C. elegans |
unc-119(ed3) III; zuIs178. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. HIS-72::GFP can be detected in germline and most somatic nuclei, but not in intestinal nuclei. Not integrated on X.
|
|
| JJ1851 |
C. elegans |
unc-119(ed3) III; zuEx181. Show Description
zuEx181[his-72(1kb 5' UTR)::YFP::GSRPVAT::HIS-72::HIS-72 (1KB 3'UTR) + 5.7 kb XbaI - HindIII UNC-119(+)]. HIS-72::YFP signal can be detected in the germline and most somatic nuclei, but not in intestinal nuclei.
|
|
| JJ2059 |
C. elegans |
unc-119(ed3) III; zuIs235. Show Description
zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
|
|
| JJ2060 |
C. elegans |
unc-119(ed3) III; zuIs236. Show Description
zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
|
|
| JJ2061 |
C. elegans |
unc-119(ed3) III; zuIs235; zuIs236. Show Description
zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
|
|
| JJ2281 |
C. elegans |
unc-119(ed3) III; zuIs258. Show Description
zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
|
|
| JJ2300 |
C. elegans |
unc-119(ed3) III; zuIs258; zuIs263. Show Description
zuIs258 [his-72p::his-72(5' UTR)::BIRA::GFP::his-72(3' UTR) + unc-119(+)]. GFP expression detectable in embryos. zuIs263 [myo-3p::myo-3(5' UTR)::npp-9::mCherry::BLRP::3xFLAG::npp-9(3' UTR) + unc-119(+)]. Reference: Steiner FA, et al. Genome Res. 2012 Apr;22(4):766-77.
|
|
| OD1854 |
C. elegans |
ltSi539 II; ltSi507 IV; nre-1(hd20) lin-15B(hd126) X; stIs10389. Show Description
ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3UTR + cnd-1p::mCherry::his-72::unc-54 3UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3UTR + hlh-1p::mCherry::his-72::tbb-2 3UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.
|
|
| RW10007 |
C. elegans |
pha-1(e2123) stIs10007 III; zuIs178 V. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10007 [pha-4 (4.1kb)) H3::H3::GFP::H3 3'UTR + pie-1p::H2B::GFP::pie-1 3'UTR + pha-4p::H1::DsRed::T1::let-858 3'UTR]. May still contain ruIs32 [pie-1::H2B-GFP + unc-119(+)] in the background.
|
|
| RW10026 |
C. elegans |
unc-119(ed3) III; stIs10026. Show Description
stIs10026 [his-72::GFP::his-72 3' UTR full length translation fusion + unc-119(+)].
|
|
| RW10029 |
C. elegans |
zuIs178; stIs10024. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. May still have unc-119(ed3) in the background.
|
|
| RW10048 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10044. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10044 [mir-57::HIS-24::mCherry + unc-119(+)].
|
|
| RW10060 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10060. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10060 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)].
|
|
| RW10062 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10050. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10050 [pha-4(4kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
|
|
| RW10064 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10064. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10064 [end-3::H1-wCherry::let-858 3' UTR + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
|
|
| RW10083 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10059. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10059 [cnd-1(3.2kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
|
|
| RW10084 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10039. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10039 [mir-61::H1.1-GFP::let-858 3' UTR + unc-119(+)].
|
|
| RW10097 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10088. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10088 [hlh-1(3.3kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
|
|
| RW10098 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10035. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10035 [eft-3-L2::H1-wCherry + unc-119(+)].
|
|
| RW10108 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10086. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10086 [ges-1::H1-wCherry + unc-119(+)].
|
|
| RW10112 |
C. elegans |
unc-119(ed3) III; stIs10026; stIs10089. Show Description
stIs10026 [his-72(1kb)::HIS-72::GFP + unc-119(+)]. stIs10089 [hlh-1(3.3kb)::HIS-24::mCherry + unc-119(+)].
|
|
| RW10131 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10131. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10131 [elt-7::H1-wCherry + unc-119(+)].
|
|
| RW10166 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10157. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10157 [dpy-7::H1-wCherry + unc-119(+)].
|
|
| RW10174 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10174. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10174 [pal-1::H1-wCherry + unc-119(+)].
|
|
| RW10175 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10138. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10138 [tbx-38::H1-wCherry + unc-119(+)].
|
|
| RW10177 |
C. elegans |
unc-119(ed3) III; zuIs178; stIs10177. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10177 [cwn-1::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
|
|
| RW10196 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10122. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10122 [hnd-1::MycCherry I (modENCODE39) + unc-119(+)].
|
|
| RW10197 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10137. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10137 [med-2::H1-wCherry + unc-119(+)].
|
|
| RW10199 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10140. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10140 [vab-7::H1-wCherry + unc-119(+)].
|
|
| RW10206 |
C. elegans |
unc-119(ed3) III; zuIs178; stIs10308. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10308 [die-1::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
|
|
| RW10230 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10224. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10224 [lin-39::H1-wCherry + unc-119(+)].
|
|
| RW10234 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10220. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10220 [end-1::H1-wCherry + unc-119(+)].
|
|
| RW10238 |
C. elegans |
unc-119(ed3) III; zuIs178; stIs10190. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10190 [C08B11.3::H1-wCherry::let-858 3'UTR]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
|
|
| RW10249 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10218. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10218 [tbx-11::H1-wCherry + unc-119(+)].
|
|
| RW10265 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10024; stIs10143. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10143 [tbx-8::H1-wCherry + unc-119(+)].
|
|
| RW10345 |
C. elegans |
unc-119(ed3) III; zuIs178; stIs10322. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10322 [ceh-43::H1-wCherry::his-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3'UTR + unc-119(+)] in the background.
|
|