Strain Information
Name | DV3285 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. |
Description | Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development. |
Mutagen | CRISPR/Cas9 homologous recombination |
Outcrossed | x0 |
Made by | Neal Rasmussen |
Laboratory | DV |
Reference | Neal R. Rasmussen, David J. Reiner, resubmitted with revisions (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development. |
Sign in
or
register an account if you want to order this strain.