More Fields
Strain Species Genotype
JK3361 C. elegans qIs76 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) Show Description
qIs76 [tra-1::GFP::beta-GAL + rol-6(su1006)]. Rollers express TRA-1::GFP in Z1/Z4, intestine, etc. qIs76 homozygotes are lethal. Heterozygotes are Rol GFP+ (pharynx). Pick Rollers with GFP+ pharynx to maintain. Reference: Chang W., et al. Development. 2004 Mar;131(6):1425-36.
JK4563 C. elegans gld-1(q126sd) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, non-GFP sterile gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RA459 C. elegans swsn-2.1(tm3309) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type that segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm3309 homozygotes. tm3309 homozygotes are maternal effect lethal (late embryo & larval lethal) and have gonadogenesis defects. Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
AG247 C. elegans tyms-1(tm2429) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm2429 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).
AG248 C. elegans mus-101(tm1761) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm1761 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).
AUM1054 C. elegans gsk-3(tm2223) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile tm2223 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
BN30 C. elegans npp-15(ok1954) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. ok1954 homozygotes arrest as larvae. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
BN358 C. elegans ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strain XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
BS5431 C. elegans prp-17(oz273) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
CER123 C. elegans ham-3(he159) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). Show Description
Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (homozygotes for hT2) and ham-3(he159) homozygotes, which are Sma, Egl, Adl, Pvl. Maintain by picking GFP+ worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. he159 allele was isolated by John Satterlee from a deletion library at Sander van den Heuvel's lab. Reference: Ertl I, et al. Genetics. 2016 Mar;202(3):961-75.
CV6 C. elegans lab-1(tm1791) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are wild-type GFP+. Homozygotes (tm1791/tm1791) are 4% Him with 22% embryonic lethality. Maintain by picking GFP+. Reference: de Carvalho et al., Genes Dev 22, 2869-2885.
CV78 C. elegans cra-1(tm2144) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP cra-1(tm2144) homozygotes (99.7% embryonic lethality, 61% larval lethality, Him). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smolikove S, et al. (2008) PLoS Genet 4(6):e1000088.
CV87 C. elegans syp-4(tm2713) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP syp-4(tm2713) homozygotes (viable but throw 97% dead eggs, 40% males). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smolikove S, et al. (2009) PLoS Genet 5(10):e1000669.
DG2913 C. elegans egl-30(ad810) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ad810 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
DG3492 C. elegans sacy-1(tm5503) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, non-GFP sacy-1(tm5503) sterile animals, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Kim S, et al. 2012 Genetics
DG3887 C. elegans inx-21(tn1540) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (inx-21(tn1540) homozygous animals are sterile, producing few germ cells). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Starich TA, Hall DH, Greenstein D. Genetics. 2014 Nov;198(3):1127-53.
DG4384 C. elegans hmgr-1(tm4386) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). Show Description
Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (homozygotes for hT2) and hmgr-1(tm4386) homozygotes, which die as young larvae (L1/L2). Maintain by picking GFP+ worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. hmgr-1(tm4386) can be maintained as homozygous fertile hermaphrodites on 20 mM mevalonolactone. Reference: P. Ranji, M. Rauthan, C. Pitot and M. Pilon, 2014. PloS ONE 9(6): e100033.
DG4454 C. elegans npp-12(ok2424) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) Show Description
Homozygous ok2424 animal are viable and fertile, but will go sterile in successive generations. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2424 homozygotes (superficially wild-type with some sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Derived from parental strain RB1874, originally provided to the CGC by the OMRF Knockout Group, part of the International C. elegans Gene Knockout Consortium. Paper_evidence WBPaper00041807
EKM4 C. elegans capg-1(tm1514) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1514 homozygotes (sterile, tm1514 m+z- are larval lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al. (2009) Curr Biol 19(1):9-19.
EV190 C. elegans gld-4(ef15) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef15 homozygotes (pale, nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schmid M, et al. Genes Dev. 2009 Apr 1;23(7):824-36.
EV57 C. elegans gls-1(ef8) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef8 homozygotes (nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Rybarska A, et al. PLoS Genet. 2009 May;5(5):e1000494.
FT207 C. elegans tat-5(tm1741) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. tm1741 homozygotes are small and sterile. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Wehman AM, et al. Curr Biol. 2011 Dec 6;21(23):1951-9.
GIN101 C. elegans thoc-2(tm1310) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (tm1310 is maternally rescued; progeny of non-GFP animals fail to give viable progeny). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Castellano-Pozo, García-Muse T, Aguilera A. 2012 R-loops cause replication impairment and genome instability during meiosis. EMBO Rep. 13(10): 923-9.
HS399 C. elegans let-526(os37) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. os37 homozygotes are Lvl and Psa. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Shibata Y, et al. Dev Biol. 2012 Jan 15;361(2):349-57.
HS886 C. elegans bet-1(os46) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP in the pharynx, and segregate WT GFP+, Sterile Psa(Phasmid socket absent) non-GFP homozygous os46) animals and dead eggs. Maintain by picking GFP progeny. Reference: Shibata et al. Development in press (2010).
JEK1001 C. elegans ddx-15 (tm4014) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm4014 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The tm4014 allele was provided by the National BioResource Project (NBRP, for C. elegans).
JK2751 C. elegans sys-1(q544) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT. q544 is homozygous embryonic lethal. hT2[qIs48] homozygotes are inviable. PIck GFP+ wild-type to maintain. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3025 C. elegans gld-1(q485) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, non-GFP sterile gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Jeong J, et al. PLoS Genet. 2011 Mar;7(3):e1001348.
JK3743 C. elegans fog-1(q785) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3934 C. elegans gld-1(q93) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). Show Description
Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (hT2 homozygotes) and non-GFP gld-1(q93) homozygotes with masculinized germlines. Some heterozygotes will also have a masculinized germline. Maintain by picking GFP worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. gld-1(q93) was isolated as a dominant suppressor of fem-1(hc17).
JK4862 C. elegans glp-1(q46) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99.
JK5657 C. elegans tra-1(q183) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). Show Description
Maintain at 15C. Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (hT2 homozygotes) and non-GFP tra-1(q183) homozygous females. Raise strain at 15C; at 20C many heterozygotes are also feminized. tra-1(q183) is temperature-sensitive for its XX, but not its XO mutant phenotype. At 25C, both q183/q183 and q183/+ are female. At 15C, q183/q183 is still always female, but q183/+ can be hermaphroditic. Maintain by picking fertile GFP worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies.
JK5943 C. elegans qSi369 II; glp-1(q224) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
KW2090 C. elegans cdk-9(tm2884) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT green-glowing heterozygotes and non-glowing cdk-9 homozygotes (arrest as L1-L2 larvae). qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).
LM99 C. elegans smn-1(ok355) I/hT2 [bli-4(e937) qIs48] (I;III). Show Description
C41G7.1. smn-1 homozygotes arrest as larvae. Segregates WT glowing hets, non-glowing arrested larvae, very rare homozygous hT2 glowing animals, and dead eggs (aneuploids). URL: http://www.celeganskoconsortium.omrf.org.
MT14728 C. elegans mfap-1(n4564 n5214) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP mfap-1 homozygotes. Pick WT GFP and check for correct segregation of progeny to maintain. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15°C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20°C mutant animals grow more slowly, have few progeny and are hyperactive; at 25°C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827.
MT15107 C. elegans lin-53(n3368) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3368 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.Class B SynMuv, Ste, Pvul. Reference: Harrison MM, Ceol CJ, Lu X, Horvitz HR. PNAS. 2006 Nov 7;103(45):16782-7.
MT19085 C. elegans hlh-2(n5287) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.
MT20187 C. elegans rba-1(n5418) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ and segregate WT green-glowing heterozygotes and non-glowing rba-1 homozygotes. rba-1(n5418) homozygotes are sterile or produce eggs that fail to hatch. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Nakano S, Stillman B, Horvitz HR. Cell. 2011 December 23; 147(7): 1525-1536.
MT20434 C. elegans chaf-1(n5453) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.
OC271 C. elegans pph-4.1(tm1598) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1598 homozygotes (produce ~100% dead eggs, slightly higher penetrance at 25C). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Peters N, et al., J Cell Sci. 2010 Mar 1;123(Pt 5):795-805.
OG576 C. elegans hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, larval-arrested ok600 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. [NOTE: Although ok600 has been reported as a 1085 bp deletion in hsf-1, sequencing of the hsf-1 PCR product revealed only an 877 bp deletion (5'-AAATAAAAATTTCTTAGAAA [877 bp deletion] TGTACATGGGATCCGGTCCA-3'). (Lamitina Lab, 12/17/2012)]
RA440 C. elegans swsn-2.2(tm3395) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type that segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm3309 homozygotes. tm3395 homozygotes are maternal effect lethal (late embryo & larval lethal) and have progeny with gonadogenesis defects. Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
RA521 C. elegans let-526(tm4795) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm4795 homozygotes. tm4795 homozygotes arrest as early larvae. Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
RB1333 C. elegans hrpr-1(ok1278) I/ ? hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) ?. Show Description
F58D5.1 Heterozygous. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP ok1278 homozygotes (larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: (04/2019) RB1333 was originally described as a homozygous strain carrying an unknown GFP transgene in the background. It was recently reported by a user that the strain is heterozygous for ok1278. Their characterization of the strain found that the deletion is balanced by a GFP-marked balancer, most likely hT2[qIs48], though the identity of the balancer has not been molecularly confirmed. Outer Left Sequence: tccaaatcctgaaaatccca. Outer Right Sequence: cagatcccagttttgcgaat. Inner Left Sequence: ttgtgtgtgcgtccaatttt. Inner Right Sequence: acattccaacggacgtcttc. Inner Primer PCR Length: 3310. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1251 C. elegans rae-1(ok1720) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F10G8.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1720 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATACATTCGAACGCGACACA. External right primer: CCAGAAACGCGGTTTAACAT. Internal left primer: GCGCTCTACTGCCAATTTTC. Internal right primer: GGAAAGCACCCGAACTATGA. Internal WT amplicon: 2465 bp. Deletion size: approximately 750 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1346 C. elegans F59B2(ok1801) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F59B2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1801 homozygotes (sterile, Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGCTCAGCAAGAAAATGAG. External right primer: GTGCTCGATGTCCACACAAC. Internal left primer: ATACCGCCTGCAATTTTCTG. Internal right primer: GCTTTTGAAATCGAAGCGAC. Internal WT amplicon: 2606 bp. Deletion size: 829 bp. Deletion left flank: TTAACAAGAAAAAATGATTTTAAAACCGTG. Deletion right flank: AAAAATTAACATGTCGAGAACCTAAGTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1391 C. elegans cdc-25.1(ok1888) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K06A5.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1888 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGGAGACCTGCAAAGTGT. External right primer: AAAAGTGGCTTGTTCATGGG. Internal left primer: GTGCTATTATTCGGCGTCGT. Internal right primer: TCAATCACGGTCCTTTTTCC. Internal WT amplicon: 2246 bp. Deletion size: 1512 bp. Deletion left flank: CCTGGAGCCCAAGTTGAACAATGCGCTCTT. Deletion right flank: ATCATAGTTGTAGCTGAAAATTGTTTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1475 C. elegans tbx-9(gk666) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T07C3.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk666 homozygotes (sterile). Viable fertile non-GFP progeny are recombinants and not homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCAGCGACCACTATGAC. External right primer: CAGAATCGATAGCCGAGAGG. Internal left primer: AATTTAATCGGCGGGTCTTC. Internal right primer: TTTGGCAATGAGGTGAGATG. Internal WT amplicon: 2334 bp. Deletion size: 892 bp. Deletion left flank: AGCGTTGTTGGACTCTGAATAGTTGGAGAT. Deletion right flank: GGAGGAGCGGGAAAACTATTCTAACTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1533 C. elegans T23D8.3(ok2016) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T23D8.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2016 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGAAGAGCAAGAAGGCGA. External right primer: GGCGCCAATACTTGTTGAAT. Internal left primer: ACACAATTGAGTCGAAGGGG. Internal right primer: CCGGTTCTGTCCAATCAGTT. Internal WT amplicon: 3212 bp. Deletion size: 1434 bp. Deletion left flank: AGGGAATATAAGGAATATTTTGAGACGGGT. Deletion right flank: ATAATTTTCTTGAAGTTTATTTTTCATAAA. Insertion Sequence: ATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807