| LP399 |
C. elegans |
rap-1(cp151[mNG-C1^3xFlag::rap-1]) IV. Show Description
mNG::RAP-1 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
|
|
| TZ181 |
C. elegans |
rap-1(pk2082) IV. Show Description
Point mutation at amino acid position 130 of rap-1 (aaaagatCagc -> aaaagatTagc).
|
|
| DV3313 |
C. elegans |
rap-1(re180) IV. Show Description
Gain-of-function allele (G12V). Low penetrance of 3? to 1? fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.
|
|
| JDW786 |
C. elegans |
srap-1(wrd318[srap-1::mNG::3xFLAG]) II. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted in the first exon after the signal sequenceof the endogenous srap-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
|
|
| NM1581 |
C. elegans |
rpy-1(ok145) II. Show Description
Viable, fertile, with no obvious behavioral or morphological phenotypes. A 1677 bp deletion in the C18H9.7 gene which encodes a C. elegans homolog of the rapysn (vertebrate) gene. The lesion deletes exons 4 through 10, leaving exons 3 and 11 in frame. The deletion junction is cagaagaaaaagttcgctttgaactaaAGAACCTATTGAAAATTCTTACTT. Previously called rap-1.
|
|
| OP700 |
C. elegans |
unc-119(tm4063) III; wgIs700. Show Description
wgIs700 [drap-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44.
|
|
| VC4892 |
C. elegans |
trap-1(gk5960[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1169 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TGAAGCTGTCGACCGTCTTTCTTCTCGCCG. Right flanking sequence: TTCTAAAAAATATATAAAAATCAATAAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|