More Fields
Strain Species Genotype
AG152 C. elegans unc-85(e1414) bli-2(e768) dpy-10(e128) II. Show Description
Unc and Dpy. Not Blistered: dpy-10 suppresses the appearance of the blisters.
CB768 C. elegans bli-2(e768) II. Show Description
Blistered cuticle. M-MATING++ 1-10%WT.
DR2078 C. elegans mIn1 [dpy-10(e128) mIs14]/bli-2(e768) unc-4(e120) II. Show Description
WT gross phenotype, with GFP semi-dominantly expressed in 4-60 cell embyros, pharyngeal muscle and gut. Segregates WT, brighter Dpy GFP mIn1 homozygotes and non-GFP bli-2 unc-4 homozygotes. Pharyngeal and gut GFP is easily seen in a UV dissecting microscope; early embryonic signal requires higher magnification. mIs14 occasionally crosses off mIn1[dpy-10], apparently by double recombination. Pick WT, check for GFP and check for correct segregation of progeny to maintain. mIs14 is ccEx9747 integrated into mIn1[dpy-10]. This is a three-construct element containing myo-2 and pes-10 promoters and a gut enhancer fused individually to GFP coding sequence.
MDH38 C. elegans ast-1(gk463) bli-2(e768) unc-4(e120) II; otIs339; otIs355; norEx42. Show Description
otIs339 [ceh-43(+)(fosmid)::GFP + ttx-3::DsRed + rol-6(su1006)]. otIs355 [rab-3::NLS::tagRFP]. norEx42 [ast-1 Cosmid + ttx-3::GFP + dat-1::mCherry]. Rollers. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.
MDH6 C. elegans ast-1(gk463) bli-2(e768) unc-4(e120) II; vtIs1 V; norEx42. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. norEx42 [ast-1(+)(cosmid) + ttx-3::GFP + dat-1::mCherry]. Rollers. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.
MDH7 C. elegans ast-1(gk463) bli-2(e768) unc-4(e120) II; ceh-43(ot406) III; vtIs1 V; norEx42. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. norEx42 [ast-1(+)(cosmid) + ttx-3::GFP + dat-1::mCherry]. Rollers. ot406 has a dopaminergic phenotype. gk463 embryonic lethality is rescued by extrachromosomal array. Pick mCherry+ animals to maintain.
MT3989 C. elegans clr-1(e1745) bli-2(e768) II. Show Description
Adult Blistered, especially in the head. Starved translucent appearance at 20c; inviable at 25C.
MT465 C. elegans dpy-5(e61) I; bli-2(e768) II; unc-32(e189) III. Show Description
Mapping strain. DpyUnc.
MT679 C. elegans nDf2/lin-31(n301) bli-2(e768) II. Show Description
Heterozygotes are Muv and segregate Muv, dead eggs, and MuvBli. Maintain by picking Muv nonBli. Alarming tendency to lose the deficiency. New stock received 9/15/97 from MT.
MT681 C. elegans nDf3/lin-31(n301) bli-2(e768) II. Show Description
Hets are Muv and segregate Muv, dead eggs, and MuvBli. Maintain by picking Muv nonBli. New stock received 9/15/97 from MT.
MT682 C. elegans nDf4/lin-31(n301) bli-2(e768) II. Show Description
Hets are Muv and segregate Muv, dead eggs, and MuvBli. Maintain by picking Muv nonBli. Received new stock from Horvitz lab 10/97.
RG3268 C. elegans +/mT1 [umnIs52] II; F10E9.11(ve768[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve768 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tTCATTTCTTCTCCTTTTTCTCCTTATCCA ; Right flanking sequence: aaaatataatttatgccagtaatgagtatc. sgRNA #1: CGAGAGGATACAGAAAAGAG; sgRNA #2: cgaaattcatgtcacgagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC10002 C. elegans bli-2(e768) F10E7.2&spon-1&F10E7.11(gk460) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F10E7.2, F10E7.4, F10E7.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk460 homozygotes (probable embryonic arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AACAATGTTTGGTCCATCCC. External right primer: ACACCAGGTTGACCTCCTTG. Internal left primer: ATGAGCCCAAATGAACCAAC. Internal right primer: AATAGGCACAATACGCCTGC. Internal WT PCR product: 5051. Deletion size: 4507 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10005 C. elegans ast-1(gk463) bli-2(e768) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk463 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10007 C. elegans bli-2(e768) C06A8.1(gk465) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C06A8.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk465 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTGCAATCGGAGTGGTTTC. External right primer: GGGAATCATGCCAATTATGG. Internal left primer: GGTCATGAAGCATTCGAGGT. Internal right primer: GAACAGAGCGTTGCATTGAA. Internal WT PCR product: 718. Deletion size: 141 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807