Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CX3940 C. elegans kyIs140 I; rol-6(e187) II; slo-1(ky399) V. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In ky399 mutants str-2::GFP is expressed in both AWX neurons. ky399 is a semi-dominant allele of slo-1, a large conductance potassium channel. PKA nsy-3(ky399). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX4103 C. elegans kyIs150 IV; sax-1(ky491) X. Show Description
kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX5000 C. elegans slt-1(eh15) X. Show Description
slt-1 mutants have no dissecting-scope phenotype. They have a 40% penetrant defect in the ventral guidance of the AVM neuron scored with mec-4::GFP, a mild defect in CAN cell migration that is enhanced by a ceh-23::GFP transgene, and a mild defect in midline crossing by PVQ neurons scorable with sra-6::GFP. slt-1(eh15) is a complex rearrangement that duplicates the endogenous slt-1 gene, but disrupts both duplicated copies. The two copies are linked on X but the exact distance between them is not known. The duplication probably extends >13 kb based on Southern blotting. Deletion breakpoints for the first copy of slt-1 are as follows: nucleotides 26219 to 28163 and 28197 to 28294 in cosmid C26G2 are deleted. The second copy of slt-1 contains the following structure: nucleotides 28197 to 28294 in C26G2 are deleted, followed by a duplication of nucleotides 28300 to 28396 in C26G2 that begins 5 nucleotides after the deletion. Both copies of slt-1 are mutant, as confirmed by both DNA sequence and RT-PCR analysis of slt-1 mRNA. Scoring for homozygosity of the slt-1 allele by PCR is difficult because of the two copies of the gene and because the small deletion and the small duplication of the second copy of slt-1 are the same size. The mutant can be followed indirectly by X linkage (very closely linked to unc-3). It may be possible to make a specific primer within the duplicated region that detects a unique band in the slt-1 mutant.
CX5893 C. elegans kyIs140 I; ceh-36(ky646) X. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-36 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX5922 C. elegans kyIs140 I; ceh-36(ky640) X. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-26 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CY397 C. elegans daf-16(mg242) I; sqt-1(sc13) age-1(mg109) II. Show Description
Sqt phenotype. The daf-16(mg242) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg242 is a nonsense mutation Trp220Amb.
CY398 C. elegans daf-16(mg255) I; sqt-1(sc13) age-1(mg109) II. Show Description
Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb.
CY399 C. elegans sqt-1(sc13) age-1(mg109) II; pdk-1(mg261) X. Show Description
Sqt phenotype. The pdk-1(mg261) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg261 is an activating missense mutation Ala447Val.
CY400 C. elegans sqt-1(sc13) age-1(mg109) II; akt-1(mg247) V. Show Description
Sqt phenotype. The akt-1(mg247) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg247 is an activating missense mutation Ala149Thr.
CY573 C. elegans bvIs5. Show Description
bvIs5 [cyp-35B1p::GFP + gcy-7p::GFP]. Little or no GFP expression in adults. GFP expressed in intestine of dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.
CYA1 C. elegans rexIs1. Show Description
rexIs1 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of Halo protein with TEV recognition site for the tobacco etch virus protease and human Keap1 protein (an established RES sensor). No phenotypic change upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.
CYA11 C. elegans ldrIs1; eeeIs1. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. Derived by crossing parental strains LIU1 and EAK102. YFP is fused to a fragment of mutant human Huntingtin protein; expression in body wall muscle cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.
CYA12 C. elegans ldrIs1; eeeIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-54 3'UTR]. Motility defect. Derived by crossing parental strains LIU1 and EAK103. YFP is fused to a fragment of mutant human Huntingtin protein; expression in body wall muscle cells of the pharynx in adults and punctate expression in body wall muscle cells of larval animals. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets.
CYA17 C. elegans rexEx9. Show Description
rexEx9 [hlh-8p::GFP::halo + rol-6(su1006)]. Pick Rollers to maintain. GFP expression in M and undifferentiated cells of the M lineage.
CYA18 C. elegans rexEx10. Show Description
rexEx10 [hsp-16p::his-6::Halo + mec-7p::mRFP]. Pick RFP+ to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces the expression of Halo protein.
CYA19 C. elegans dvIs19 III; rexEx11. Show Description
dvIs19 [gst-4p::GFP::NLS] III. rexEx11 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of Halo::TEV::Keap1 protein. Oxidative stress induces expression of GFP. Superficially wild-type.
CYA2 C. elegans rexIs2. Show Description
rexIs2 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Array is prone to silencing; pick RFP animals to maintain array. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of mCherry with tom70 (outer mitochondrial membrane targeting sequence from yeast) and Halo protein. Global red fluorescence upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.
CYA20 C. elegans dvIs19 III; rexEx12. Show Description
dvIs19 [gst-4p::GFP::NLS] III. rexEx12 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of mCherry::Halo protein. Oxidative stress induces expression of GFP.
CYA21 C. elegans dvIs19 III; rexEx13. Show Description
dvIs19 [gst-4p::GFP::NLS] III. rexEx13 [hsp-16p::HA::wdr-23::halo + mec-7p::mRFP]. Pick RFP+ worms to maintain. Constitutive red fluorescence in touch-receptor neurons. Heat shock induces expression of HA::WDR23::Halo protein. Oxidative stress induces expression of GFP.
CYA3 C. elegans rexEx1. Show Description
rexEx1 [myo-2p::GFP::Halo + mec-7p::mRFP]. Pick GFP+ to maintain. Mosaic expression of green fluorescence (GFP) in pharynx and red fluorescence (mRFP) in touch-receptor neurons.
CYA4 C. elegans rexEx2. Show Description
rexEx2 [ges-1p::GFP::Halo + mec-7p::mRFP]. Pick GFP+ to maintain. Mosaic expression of green fluorescence (GFP) in the intestine and red fluorescence (mRFP) in touch-receptor neurons.
CYA5 C. elegans rexEx3. Show Description
rexEx3 [myo-3p::GFP::Halo + mec-7p::mRFP]. Pick GFP+ to maintain. Mosaic expression of green fluorescence (GFP) in body-wall muscle and red fluorescence (mRFP) in touch-receptor neurons.
CYA6 C. elegans rexEx4. Show Description
rexEx4 [myo-2p::mCherry::P2A::Flag::UltraID::unc-54 3'UTR]. Pick mCherry+ to maintain. Mosaic expression of red fluorescence (mCherry) in pharynx. P2A is the self-cleaving peptide sequence.
CYA7 C. elegans rexEx5. Show Description
rexEx5 [ges-1p::mCherry::P2A::Flag::UltraID::unc-54 3'UTR]. Pick mCherry+ to maintain. Mosaic expression of red fluorescence (mCherry) in the intestine. P2A is the self-cleaving peptide sequence.
CYA8 C. elegans rexEx6. Show Description
rexEx6 [myo-3p::mCherry::P2A::Flag::UltraID::unc-54 3'UTR]. Pick mCherry+ to maintain. Mosaic expression of red fluorescence (mCherry) in body-wall muscle; punctate mCherry signals in some animals. P2A is the self-cleaving peptide sequence.
CZ10123 C. elegans rabx-5(qa7800) III. Show Description
rabx-5(qa7800) mutants show decreased protein localization of YFP::RAB-5 in the cell bodies but increased protein localization within the dorsal cord in both synaptic and intersynaptic regions
CZ1072 C. elegans unc-62(e917) V. Show Description
Inversion which may serve as a balancer for the center of LG V. Maternal effect lethal allele which results in 57% embryonic arrest, 40% larval arrest, and 3% which survive to be fertile adults with a variety of defects including Egl, Unc and Vab.
CZ11771 C. elegans nsf-1(ty10) I; muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Egl, semi-Sterile, embryonic & larval lethality. Lethal in trans to Df. Defective fusion of anchor cell to uterine seam. Maintain under normal conditions. Reference: Choi J, et al., Dev Biol. 2006 Sep 1;297(1):87-102.
CZ13896 C. elegans juIs319. Show Description
juIs319 [col-19p::GCaMP3 + col-19p::tdTomato]. col-19p::GCaMP3 expression is induced by either laser or needle wounding. col-19 is an adult-specific collagen and is not expressed until the end of the L4 larval stage. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7.
CZ14748 C. elegans juIs352. Show Description
juIs352 [col-19p::GFP::moesin]. GFP::moesin expression labels F-actin by fusing GFP to sequences that encoded the C-terminal end of the sole Drosophila MER homolog, moesin. The F-actin ring (GFP::moesin) is induced upon needle wounding. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7.
CZ1566 C. elegans lin-15B&lin-15A(n765) juIs109 X. Show Description
juIs109 [efn-4::GFP + lin-15(+)] X. Superficailly wild-type. GFP expression detected under high power in a subset of head neurons, primary vulval cells, and a pair of pharyngeal neurons. Reference: Chin-Sang ID, et al. Development. 2002 Dec;129(23):5499-510.
CZ16143 C. elegans juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. Show Description
juEx4586 [rgef-1p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. RFP expression in AIY neuron. Weak light green signals were observed in the neurons using compound scope although this is only the former half of the split GFP. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.
CZ17515 C. elegans juSi94 II; rps-18(ok3353) IV. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. Superficially wild-type. No fluorescence; carries only one portion of a split GFP reporter for visualization of ribosomes. Allows inducible GFP fluorescence of ribosomes when combined with GFP1-10 expression in tissue of choice. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18018 C. elegans juSi94 II; rps-18(ok3353) IV; juEx5375. Show Description
juSi94 [rps-18p::GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5375 [col-19p::GFP1-10 + ttx-3p::RFP]. Pick RFP+ to maintain. Expression of split GFP reporter labels ribosomes in the epidermis. Reference: Noma K, et al. Elife. 2017 Aug 2;6:e26376. doi: 10.7554/eLife.26376.
CZ18020 C. elegans juSi94 II; rps-18(ok3353) IV; juEx5377. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5377 [myo-3p::GFP1-10 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. Muscle-specific expression of split GFP reporter allows visualization of ribosomes in muscle. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18412 C. elegans juSi94 II; rps-18(ok3353) IV; glo-4(ok623) V; juEx5515. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18550 C. elegans juSi123 II; rpl-29(tm3555) IV. Show Description
juSi123 [rpl-29::GFP] II. Strong GFP signal allowing visualization of ribosomes. GFP inserted at C-terminus of RPL-29. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ18975 C. elegans juIs338. Show Description
juIs338 [mec-4p::ebp-2::GFP + ttx-3p::RFP]. Derived by integration of array in parental strain CZ12264. Reference: Ghosh-Roy A, et al. Dev Cell. 2012 Oct 16;23(4):716-28. Chen L, et al. Elife. 2015 Sep 4;4. doi: 10.7554/eLife.08695.
CZ19297 C. elegans juSi94 II; rps-18(ok3353) juIs409 IV. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs409 [rgef-1p::GFP1-10 + ttx-3p::RFP] IV. Pan-neuronal-specific expression of split GFP reporter allows visualization of ribosomes in neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ19299 C. elegans juSi94 juIs438 II; rps-18(ok3353) IV. Show Description
juIs438 [mec-4p::GFP1-10 + mec-4p::tagRFP] II. juSi94 [rps-18p::GFP11::rps-18]. Expression of split GFP reporter labels ribosomes in touch neurons. Generated in N2 background. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ19982 C. elegans mcu-1(ju1154) IV. Show Description
Superficially wild-type. No uptake of calcium in mitochondria after wounding. Reference: Xu S, Chisholm AD. Dev Cell. 2014 Oct 13; 31:48-60.
CZ20132 C. elegans juSi94 II; rps-18(ok3353) IV; juIs463. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs463 [flp-13p::GFP1-10 + ttx-3p::RFP]. DD motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in those neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ20215 C. elegans tba-1(ju89) I. Show Description
Gain-of-function allele isolated sem-4; juIs1 screen in 1997. ju89 has slightly semi-dominant effects, and the gf phenotype is most obvious in homozygous. This outcrossed strain does not carry a sem-4 mutation or juIs1. References: Kurup N, et al. Curr Biol. 2015 Jun 15;25(12):1594-605. Kurup N, et al. PLoS Genet. 2017 Jun 21;13(6):e1006844.
CZ22695 C. elegans juEx6908. Show Description
juEx6908 [nmr-1p::PH::miniSOG(Q103L) + nmr-1p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Interneuron expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ22698 C. elegans juEx6911. Show Description
juEx6911 [unc-25p::PH::miniSOG(Q103L) + unc-25p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in GABAergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ22703 C. elegans juEx6916. Show Description
juEx6916 [myo-3p::PH::miniSOG(Q103L) + myo-3p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in body wall muscles. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ23277 C. elegans juEx7101. Show Description
juEx7101 [col-19p::PH::miniSOG(Q103L) + ttx-3::RFP]. Pick RFP+ to maintain. Adult epidermal expression of PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ23279 C. elegans juEx7103. Show Description
juEx7103 [unc-17p(beta)::PH::miniSOG(Q103L) + acr-2p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in cholinergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. [NOTE: strain was previously described as carrying ttx-3::GFP, but appears to be ttx-3::RFP instead.]
CZ23281 C. elegans juEx7105. Show Description
juEx7105 [mec-4p::PH::miniSOG(Q103L) + mec-4p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in mechanosensory neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ24092 C. elegans gip-2(lt19[gip-2::GFP::loxP::Cbr-unc-119(+)::loxP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.