Search Strains

mIs14 [myo-2p::GFP + pes-10p::GFP]. Him. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and Egl non-GFP ez25 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.

Heterozygotes are WT and GFP+ in the pharynx. mIn1[dpy-10(e128) mIs14] homozygotes are Dpy and GFP+ in the pharynx. Homozygous fkh-6(ez16) hermaphrodites are sterile and have gonadogenesis defects. Homozygous fkh-6(ez16) males are sterile and strong Gon, "white patch" phenotype. 25% of males have a hermaphrodite vulval structure.

tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.

Dpy. pag-1(ls2) is recessive and has not visible phenotype by itself. It increases the expression of certain lacZ fusion genes such as lacZmec-7, unc-86lacZ and unc-4unc-76lacZ.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] IV. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. mCherry::PH marks cell membranes. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]

eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-45 3'UTR]. Motility defect. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]

eeEx100 [his-24::GFP + rol-6(su1006)]. Rollers. Nuclear GFP fluorescence detected beginning with the eight-cell stage of the embryo in all somatic nuclei without the P-cell. In adults the GFP signal in somatic cells and in few hermaphrodites in undifferentiated germ nuclei and in oocytes and sperm. About 20% transmission.

eeEx106 [hil-1::GFP + rol-6(su1006)]. GFP expression in body wall muscles, in the vulva sex muscles, in the marginal cells of the pharynx, in a limited number of head neurons, in the cytoplasm of excretory cells. The expression starts in the about 100-cell embryo in a few cells in the periphery in the nucleoplasm and in the nucleoli. Complex extrachromosomal arrary....pick Rollers. About 20% Rollers.

Null allele of ben-1. Benzimidazole resistant. Can be used for benzimidazole resistance studies or selection. Reference: Hahnel SR, et al. PLoS Pathog. 2018 Oct 29;14(10):e1007226. doi: 10.1371/journal.ppat.1007226. PMID: 30372484.

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from compost from the Olive Mushroom Farms near the town of Limuru, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis elegans wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis briggsae wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis briggsae wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. When tph-1 mutants carrying mudIs1 are exposed to blue light, the worms continue to move rather than stopping like wild-type animals. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.

mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.

mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.

oxIs12 [unc-47p::GFP + lin-15(+)]. Integration maps at +2.0 on X. Expression of GFP in all GABAergic neurons.

oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Psoralen integration of oxEx129 [unc-49Bp(long)::GFP + lin-15(+)]. Dorsal and ventral.

T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu

Abnormal posterior body muscle contractions during defecation. Derived by single outcrossing of MT1733; allelic to n2303.

Isolated by Michael Ailion from rotting apricot from home of Wayne Davis and Danielle Endres in Salt Lake City, Utah, 8/4/2006, under tree on north side of house. Coordinates: 40° 42' 26.16" N, 111° 52' 3.27" W. Animals move very rapidly. Strain started from a single L4 hermaphrodite and grown three generations before freezing. 18S rDNA sequence differs from C. briggsae NCBI entry (PB102), but is identical to the 18S sequence of AF16, HK104, PB800 and VT847. Cross-fertile with AF16. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Mixed "strain" started from many different worms that emerged from the same apricot that gave rise to strain EG4181. Some worms emerged as dauers, but there were also L4s and adults. Consists of a mix of the worms that came from the apricot to try to maintain as much diversity as possible in the population and thus is not a true strain in the traditional sense. It will be sent as contaminated worms since it cannot be cleaned up without going through a bottleneck. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]

Male-female strain. Maintain by mating. Caenorhabditis sp. 6 wild isolate. Isolated by Michael Ailion and Ana-Joao Rodrigues from a rotting apple collected from the home of Anabela Fernandes in Amares, Portugal (address: Dr. Adolofo Vilela, no. 29, 4720-019 Amares, Portugal). Coordinates: 41 degrees, 37', 43.577 " N; 8 degrees, 20', 51.421 " W. Apple collected March 28, 2007. The apple produced a number of growing animals in different stages, including adults of both sexes. Male/Female Caenorhabditis species. 18S RNA sequence places it closest to PS1010 C. sp. 3.

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. Wild type worms with mCherry fluorescence in pharyngeal and body wall muscle. Visible on dissection microscope at high magnification. Complex transgene insertion in place of Mos1 allele ttTi5605. Useful for following "invisible" insertions at ttTi5605 site by Mos1 Single Copy gene Insertion (MosSCI). Please note: The insertion was a complex event pulling in more than one transgene and parts of the array. Therefore, the exact molecular structure of the insert is not known. Therefore the strain should NOT be used as a control for insert copy number or other detailed molecular controls of MosSCI insertions. Succesfully used as a balancer for the ttTi5605 locus.

Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).

Caenorhabditis sp. 9 Male-female strain. Isolated from a sample collected by Joel Ehrenkranz on May 20, 2008, around 11 AM in Shinkolobwe, Katanga Province, Democratic Republic of the Congo (~11°S, 26°E). The sample was collected from worked soil which contained organic material around the foundation of a wattle hut. This time of year was the dry season in Katanga Province, so daytime temperatures were in the high 70s and nighttime temperatures in the low 50s. The specimen was placed in a ziplock bag with a slice of apple for transport to Susan Mango's lab at the Huntsman Cancer Institute, Salt Lake City, Utah. From the date of collection until the specimen reached the lab was approximately 2 weeks.

Caenorhabditis sp. 14 Male-female strain. Isolated from a rotten horse chestnut (Tahitian chestnut?) collected by David Ailion on the island of Moorea (17.53 S, 149.83 W) on July 24, 2009.

qqIr7 [peel-1(qq99)] I. oxSi78 [peel-1p::peel-1 (introns included)::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. Genetic background is a mixture of N2 and wild isolate EG4348. The oxSi78 insertion produces a PEEL-1::GFP translational fusion. PEEL-1::GFP is expressed in the spermatogenic germline and packaged into sperm. PEEL-1::GFP appears to localize to fibrous body-membranous organelles. PEEL-1::GFP does not rescue peel-1(qq99). Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.

oxSi87 [peel-1p::N-terminal 12 amino acids of PEEL-1::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. GFP is expressed in the spermatogenic germline. During spermatogenesis, GFP is packaged into sperm. Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.

Unc. MosSCI insertion strain with unc-18 marker instead of unc-119. Mos1 insertion in Chr I. Compatible with mosSCI targeting vectors pCFJ448 (Gateway) and pCFJ676 (MCS).

Caenorhabditis sp. 19 Male-female strain. Isolated from a rotten fruit/seed of Ausubo (Manilkara dentata) collected by Susan Dalton in El Yunque, Puerto Rico, near El Verde (~18.3°N, 65.8°W), around March 28, 2010.

oxIs609 [acr-5p::GAP-43::GFP + lin-15(+)] X. GFP localized to axonal membranes of acr-5 expressing neurons. acr-5 promoter drives expression of reporter containing 40 aa myristoylation sequence of GAP43 fused to GFP. oxIs609 was generated by X-ray integration of oxEx81in N2 background. Reference: Rawson RL, et al. Curr Biol. 2014 Mar 31;24(7):760-5. doi: 10.1016/j.cub.2014.02.025. PMID: 24631238.

oxTi374 [unc-18(+) + ttTi5605 NeoR] V. oxEx1873 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi374 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in repressive region at position 3,339,184 of Chr V; can be used with standard ttTi5605 mosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

oxTi176 [unc-18(+) + ttTi5605 NeoR] V. oxEx1807 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi176 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in a generally permissive region at position 15,383,969 of Chr V; can be used with standard ttTi5605 mosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

oxTi173 [unc-18(+) + ttTi5605 NeoR] V. oxEx1795 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi173 is a Mini-Mos insertion of ttTi5605 MosSCI landing site in a repressive region at position 17,523,246 of Chr V; can be used with standard ttTi5605 MosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

oxTi357 [unc-18(+) + ttTi5605 NeoR] V. oxEx1876 [Cbr-unc-119(+)]. Pick wild-type to maintain. oxTi357 is a Mini-Mos insertion of ttTi5605 mosSCI landing site in a repressive region at position 20,921,413 of Chr V; can be used with standard ttTi5605 MosSCI targeting vectors. Animals carrying the array are wild-type and segregate Unc animals that can be used for MosSCI injections. This strain carries a rescuing unc-119(+) array for easier maintenance; inject Unc-119 animals that have lost the array. Reference: Froekjaer-Jensen et al. Cell (2016).

oxTi551 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]. [NOTE (8-17-2016) One researcher has noticed an unusual segregation pattern of the oxTi551 insertion. This strain may contain more than one insertion or is possible mis-mapped - the authors recommend that you verify the location of this insertion prior to using it as a genetic marker.] Maintain at 20C; somewhat sick at 25C. Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.

oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi179 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi444 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi177 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.