Strain Information
| Name | DV3313 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | rap-1(re180) IV. |
| Description | Gain-of-function allele (G12V). Low penetrance of 3˚ to 1˚ fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x3 |
| Made by | Neal Rasmussen |
| Laboratory | DV |
| Reference | Neal R Rasmussen, Daniel J Dickinson, David J Reiner (2018) Ras-Dependent Cell Fate Decisions Are Reinforced by the RAP-1 Small GTPase in Caenorhabditis elegans, Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933. PMCID: PMC6283165. |
Sign in
or
register an account if you want to order this strain.