More Fields
Strain Species Genotype
AC68 C. elegans unc-29(e1072) aph-2(zu181)/unc-13(e1091) lin-11(n566) I. Show Description
Heterozygotes are WT and segregate WT, Unc Egls, and dead eggs.
AH75 C. elegans apr-1(zh10) unc-29(e1072) I; zhEx11. Show Description
zhEx11[apr-1(+) + sur-5::GFP]. Unc. Segregates dead eggs that have lost the rescuing array.
BA521 C. elegans fer-1(hc1) unc-29(e1072) I. Show Description
Temperature sensitive. Maintain at 15C. Unc.
BA522 C. elegans fer-1(hc13) unc-29(e1072) I. Show Description
Temperature sensitive. Maintain at 15C. Unc.
BA709 C. elegans fer-1(hc80) unc-29(e1072)/sDf6 I. Show Description
Heterozygotes are WT and segregate WT heterozygotes, Sterile Unc (fer-1 unc-29 homozygotes) and L1 lethals (sDf6 homozygotes). hc80 is a nonconditional sterile. hc80 sperm have short pseudopods.
BW1102 C. elegans dpy-5(e61) mei-2(ct102) unc-29(e1072) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals that have lost the duplication are DpyUncMel. mei-2 is non-conditional recessive maternal effect lethal.
BW589 C. elegans lin-10(e1438) unc-29(e1072) I. Show Description
Vul and Unc.
BW774 C. elegans lin-28(n719) unc-29(e1072) I. Show Description
Egl and Unc.
BW837 C. elegans unc-29(e1072) lin-11(n566) I. Show Description
Vul and Unc.
CB1072 C. elegans unc-29(e1072) I. Show Description
Very sluggish as L1, moves better as adult. Weak kinker. Head region stiff. Moves better in reverse, fairly active. Levamisole resistant.
CE778 C. elegans unc-29(e1072) aph-1(ep140)/fog-3(q443) I. Show Description
This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
DA1055 C. elegans unc-29(e1072) eat-18(ad820) I. Show Description
Unc. Semi-dominant Eat. pka eat-18.
DL160 C. elegans lin-59(n3192) unc-29(e1072) I. Show Description
DR189 C. elegans dpy-5(e61) daf-8(e1393) unc-29(e1072) I. Show Description
Temperature sensitive dauer constitutive. Dpy. Unc.
DR437 C. elegans dpy-5(e61) unc-29(e1072) I. Show Description
Dpy. Unc.
DR848 C. elegans daf-8(e1393) unc-29(e1072) I. Show Description
Unc-weak kinker, doesn't back well. Temperature sensitive dauer constitutive. Maintain at 15C. Makes high percentage of dauers at 25C. tsp for dauer formation is L1 molt. Type C Egl. Active. Resistant to 1 mM levamisole. Sensitive to hypoosmotic shock.
DR943 C. elegans daf-8(e1393) fer-1(hc1) unc-29(e1072) I. Show Description
Unc. Temperature sensitive dauer constitutive. Temperature sensitive fertilization defective (late). UncDaf at 25C, Unc at 15C.
EJ275 C. elegans unc-29(e1072)/dxDf1 I. Show Description
Heterozygotes are WT and segregate WT, Uncs and dead eggs.
EJ374 C. elegans gon-2(dx22) fer-1(hc1) unc-29(e1072) I. Show Description
Unc. Temperature senstive for both gon-2 and fer-1. Maintain at 15C. Will also grow at 20C. Received new stock 10/12/00 from EJ.
GR1371 C. elegans lars-2(mg312) unc-29(e1072) I; nDp4 (I;V)/+. Show Description
lars-2(mg312) unc-29(e1072) homozygotes are Unc, slow growing, sterile, and have extended life span. Balanced worms are slightly Egl, otherwise WT.
HR1327 C. elegans mel-26(tm1664) unc-29(e1072) I. Show Description
Temperature sensitive. Maintain at 15C. Unc.
HR75 C. elegans mei-1(b284) unc-29(e1072)/mei-1(ct46) unc-13(e1091) I. Show Description
Heterozygotes are WT. ct46 is a dominant, temperature sensitive maternal effect lethal. ct46 homozygotes are viable and fertile at 15C. b284 is a non-conditional, recessive maternal effect lethal. Heterozygotes give more viable progeny at 15C than 25C.
HR98 C. elegans mel-26(ct61) unc-29(e1072) I. Show Description
Dominant temperature sensitive maternal effect lethal. Will segregate some Vab. Maintain at 15C: about 30% of homozygotes hatch at 15C. Will not grow at 20C or 25C. Unc.
JK1553 C. elegans ces-1(n703) qDf9/unc-29(e1072) lin-11(n566) I. Show Description
Heterozygotes are Ces and throw dead eggs and Unc Vuls. ces-1(n703) is dominant. Well balanced. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK2761 C. elegans sys-1(q544)/unc-29(e1072) fog-3(q470) I. Show Description
Heterozygotes are WT and segregate WT, Unc Fogs and Sterile Spfs (white patch) phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MH2211 C. elegans unc-29(e1072); sur-6(ku123); kuIs57. Show Description
kuIs57 [col-10p::lin-45(gf) + sur-5::GFP]. Reference: Yoder JH, et al. EMBO J. 2004 Jan 14;23(1):111-9.
MT15080 C. elegans sup-17(n1306) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1306 is recessive late larval lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15081 C. elegans sup-17(n1315) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1315 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15082 C. elegans sup-17(n1318) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1318 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15083 C. elegans sup-17(n1319) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1319 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT15084 C. elegans sup-17(n1320) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1320 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
MT2941 C. elegans sup-17(n1305) unc-29(e1072) I. Show Description
ts. Dpy. Egl. sup of lin-12(d).
MT2956 C. elegans dpy-14(e188) unc-29(e1072) I. Show Description
ts Dpy. e1072am.
MT2966 C. elegans sup-17(n1313) unc-29(e1072) I. Show Description
Suppressor of lin-12(d).
MT2967 C. elegans sup-17(n1314) unc-29(e1072) I. Show Description
Suppressor of lin-12(d).
MT2969 C. elegans sup-17(n1316) unc-29(e1072)/dpy-14(e188) I. Show Description
Heterozygotes are WT and segregate WT, Dpys and very slow growing Uncs. Maintain by picking WT.
MT2970 C. elegans sup-17(n1317) unc-29(e1072) I. Show Description
Suppressor of lin-12(d).
MT3198 C. elegans unc-13(e1091) unc-29(e1072) I. Show Description
MT3632 C. elegans lin-10(n1511) unc-29(e1072) I. Show Description
Vul. Unc-Very sluggish as L1, moves better as adult. Weak kinker. Head region stiff. Moves better in reverse, fairly active.
MT7897 C. elegans lin-41(n2914)/unc-29(e1072) lin-11(n1281) I. Show Description
Heterozygotes are WT and segregate WT, UncVul and lin-41 (Dpy, Scrawny and Sterile).
MT9647 C. elegans unc-29(e1072) sqv-5(n3039)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT and segregate WT, UncSqv and dead eggs. n3039: mid-L4 vulva abnormal, sterile.
PJ1015 C. elegans unc-29(e1072) I; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc.
PS3465 C. elegans unc-38(sy576) unc-29(e1072) I; unc-64(e246) III; him-5(e1490) V. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
SP1914 C. elegans unc-29(e1072) I; mnIs7 X. Show Description
mnIs7 [lin-44::GFP + unc-29(+)].
SP1933 C. elegans unc-29(e1072) I; him-5(e1490) V. Show Description
TB1 C. elegans ceh-6(mg60)/dpy-5(e61) unc-29(e1072) I. Show Description
ceh-6(mg60) is lethal. Maintain by picking WT and check that it throws 1/4 Dpys. mg60 is a 1.3 kb deletion that removes part of the conserved POU-specific domain. PCR with primers PCR6-5 GAA-TTC-ATG-AAA-TCG-GAG-GCG-T (->) and PCR6-3 GTG-AGA-AGT-GAA-GAG-GAT-TGT-A (<-) yields a band of about 1.6 kb instead of 280 bp as in N2. Backcrossed more than 10 times; in addition, the left arm of LG I was recombined with lin-28 to remove the mutator locus.
PS7220 C. elegans flp-34(sy810) V. Show Description
flp-34(sy810) is a CRISPR/Cas9-engineered 1,365-bp deletion flanked by the sequences TCAAATTTTTTGAGGAAATCCTCCTGAAAC and AATATTTTCGAGTTTCGAAACATTTCAAAT with a AATATATTTTCGAGTTTCGAAACATATTTTCGAGTTTCGAAACAC insertion. Reference: Lee JS, et al. Proc Natl Acad Sci USA. 2017 Dec 12;114(50):E10726-E10735. PMID: 29167374