BS5633 |
C. elegans |
ieSi64 II; lag-1(oz536oz537[lag-1::AID*::3xHA]) IV. Show Description
ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https://doi.org/10.17912/micropub.biology.000310) .
|
|
DQM104 |
C. elegans |
bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075.
|
|
DQM1051 |
C. elegans |
lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
DQM1066 |
C. elegans |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
DQM1068 |
C. elegans |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
|
|
DQM1070 |
C. elegans |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
|
|
DQM1072 |
C. elegans |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
|
|
DQM594 |
C. elegans |
bmdSi170 I. Show Description
bmdSi170 [loxN::eft-3p::his-58::GFP::3xHA] I. Superficially wild-type. bmdSi170 is a single-copy CRISPR/Cas9-engineered insertion of HIS-58 C-terminally tagged with non-codon-optimized GFP and driven by the ubiquitous eft-3 promoter. Reference: Azmi MA, et al. bioRxiv 2020.10.17.344069; doi: https://doi.org/10.1101/2020.10.17.344069
|
|
DV3208 |
C. elegans |
daf-15(re147[daf-15::mNG::2xHA]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.
|
|
DV3765 |
C. elegans |
scd-1(re305[scd-1::mKate2::2xHA]) X. Show Description
mKate GLO (germline optimized) tag inserted at C-terminus of endogenous SCD-1. Red fluorescence in all nuclei. Cas9 guide + PAM: GACTTGGAAGAAGACGGTGG+AGG. Reference: Ailion M, et al. In preparation.
|
|
EL661 |
C. elegans |
pup-3(om149[3xHA::pup-3]) I. Show Description
3xHA tag inserted at N-terminus of endogenous pup-3 locus using CRISPR/Cas9. Reference: Li Y, et al. Development. 2018 Oct 10;145(19):dev165944. doi: 10.1242/dev.165944. PMID: 30305273.
|
|
FT183 |
C. elegans |
cdc-42(gk388) II; unc-119(ed3) III; xnIs78. Show Description
xnIs78 [cdc-42p::2xHA::cdc-42 + unc-119(+)]. Superficially wild-type. Reference: Anderson DC, et al. (2008) Science 320(5884):1771-4.
|
|
JDW182 |
C. elegans |
bmdSi15 lmn-1(wrd39[lmn-1::1xGFP11]) I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. GFP11 tag inserted into endogenous lmn-1 locus via CRISPR/Cas9 insertion into parental strain DQM104. Reference: Gregory EF, et al. MicroPubl Biol. 2023 Dec 13:2023:10.17912/micropub.biology.001022. doi: 10.17912/micropub.biology.001022. eCollection 2023. PMID: 38152058.
|
|
JJ2059 |
C. elegans |
unc-119(ed3) III; zuIs235. Show Description
zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
|
|
JJ2061 |
C. elegans |
unc-119(ed3) III; zuIs235; zuIs236. Show Description
zuIs235 [his-72(1-kb 5' UTR):: BIOTAG::3XHA::HIS-72::his-72(1-kb 3' UTR) + unc-119(+)]. zuIs236 [his-72(1-kb 5' UTR)::BIRA::GFP:: his-72(1-kb 3' UTR) + unc-119(+)]. Superficially wild-type.
|
|
JLF291 |
C. elegans |
wowEx68. Show Description
wowEx68 [ges-1p::3xHA::TurboID::unc-54 3'UTR + myo-2p::mCherry]. Pick mCherry+ to maintain. TurboID with HA tag is expressed in intestinal cells. Reference: Branon TC, et al. Nat Biotechnol. 2018 Oct;36(9):880-887.
|
|
JLF294 |
C. elegans |
wowEx71. Show Description
wowEx71 [ges-1p::3xHA::miniTurbo::unc-54 3'UTR + myo-2p::mCherry]. Pick mCherry+ to maintain. miniTurbo with HA tag is expressed in intestinal cells. Reference: Branon TC, et al. Nat Biotechnol. 2018 Oct;36(9):880-887.
|
|
NK2694 |
C. elegans |
bmdSi15 rpl-31(qy110[rpl-31::gfp11]) I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.
|
|
NK2730 |
C. elegans |
rpl-4(qy128[rpl-4::gfp11]) bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-41 locus.
|
|
NK2789 |
C. elegans |
bmdSi15 I; shy61(sec-61.B::GFP11x2) IV. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). 2x split GFP tag (GFP11) inserted into the C-terminus of the endogenous sec-61.B locus.
|
|
NK2902 |
C. elegans |
bmdSi15 I; rpl-31(qy189[rpl-31::ZF1::GFP11]) I; zif-1(gk117) III; qyIs463. Show Description
qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.
|
|
NK3080 |
C. elegans |
cpIs91 II; sbp-1(qy94[mNG::sbp-1]) III. Show Description
cpIs91 [lag-2p::2x mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR LoxN] II. sbp-1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
OH10997 |
C. elegans |
otIs264 III; ntIs1 V; otIs305. Show Description
otIs264 [ceh-36p::tagRFP] III. ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. Rollers. Maintain at 15-20C. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
|
|
OH11053 |
C. elegans |
ntIs1 otIs305 otIs355 V. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)] V. otIs355 [rab-3::tagRFP] V. Maintain at 15-20C. Rollers. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
|
|
OH11054 |
C. elegans |
pha-1(e2123) III; him-8(e1489) IV; ntIs1 V; otIs305; otEx4445. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. otEx4445 [snb-1::NLS::RFP + pBX]. Rollers. Maintain by picking RFP+ Rollers. Maintain at 20C to maintain extrachromosomal array. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
|
|
OH11117 |
C. elegans |
otIs306, otEx4963. Show Description
otEx4963 [lsy-6p(fosmid delta 150bp downstream)::GFP + ttx-3:mCherry]. Maintain otEx4963 by picking animals with mCherry in the AIY neurons. otIs306 [hsp-16.2::che-1::3xHA + rol-6(su1006)]. Rollers.
|
|
OH14454 |
C. elegans |
otIs587; otIs304. Show Description
otIs587 [gcy-5(fosmid)::SL2::NLS::GFP + ttx-3p::mCherry]. otIs304 [hsp16-2p::che-1::3xHA::BLRP + rol-6(su1006)]. Rollers. GFP reporter tag inserted into gcy-5(+) fosmid. gcy-5 is normally expressed in ASER and RIGL/R neurons, but upon heatshock, expression of CHE-1 induces ectopic gcy-5 expression (the extent of ectopic expression is dependent on the timing of the heatshock). Reference: Patel T & Hobert O. eLife 2017.
|
|
OH9846 |
C. elegans |
otIs305 ntIs1 V. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp16-2p::che-1::3xHA::BLRP + rol-6(su1006)] V; injected as complex array with Pvu II bacterial DNA. Rollers. Rol is prone to silencing in otIs305, but hsp transgene is still active in Hobert Lab assays. otIs305 is homozygous by PCR analysis (Hobert). Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
|
|
SP2686 |
C. elegans |
smu-2(mn416) unc-52(e669su250) II; unc-36(e251) III; mnEx151. Show Description
mnEx151 [smu-1::GFP + smu-2::3xHA + unc-36(+)]. Animals carrying the array should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Without the array smu-2(mn416) suppresses unc-52(e669su250) so animals don't show the Unc-52 phenotype. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.
|
|
SP2688 |
C. elegans |
smu-1(mn415) I; unc-36(e251) III; mnEx156. Show Description
mnEx156 [smu-2::GFP + smu-1::3xHA + unc-36(+)( R1p16)]. Maintain by picking non-Unc.
|
|
WBM409 |
C. elegans |
nhr-49(nr2041) I; wbmEx149. Show Description
wbmEx149 [ges-1p::3xHA::nhr-49(cDNA)::unc-54 3'UTR + myo-3p::mCherry::unc-54 3'UTR]. mCherry expression in muscle cells. Pick fluorescent animals to maintain. Intestine-specific rescue of nhr-49 null animals. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
|
|
WHY10 |
C. elegans |
glh-1(how3[3xHA::TurboID::glh-1]) I. Show Description
3xHA::TurboID tag inserted at the N-terminus of the endogenous GLH-1. TurboID::GLH-1 promiscuously labels proteins at 20C. Transgene generated in N2 background. Reference: Price I, et al. ELife. 2021 Nov 3;10:e72276. doi: 10.7554/eLife.72276.
|
|
WJA1025 |
C. elegans |
rps-10(srf1025[rps-10::3xHA]) I. Show Description
3xHA tag inserted at C-terminus of endogenous rps-10 locus. Some growth defects on its own, which can be exacerbated in conjunction with mutants of no-go mRNA decay factors. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
|
|
WJA1190 |
C. elegans |
rps-20(srf1190[rps-20::3xFLAG]) I. Show Description
3xHA tag inserted at C-terminus of endogenous rps-20 locus. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
|
|
AA1 |
C. elegans |
daf-12(rh257) X. Show Description
daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele. Occasional abnormal dauers under exhausted conditions.
|
|