| CZ28766 |
C. elegans |
col-19::mNG(syb4625) X. Show Description
mNG inserted at C-terminus of endogenous col-19 locus. Derived by out-crossing parental strain PHX4625 2x to N2.
|
|
| CZ29092 |
C. elegans |
jsIs973 III; efa-6(*ju1658[GFP::efa-6] ju1903) IV. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for the mechanosensory neurons. ju1903 deletion removes N-terminus of EFA-6 and disrupts all known isoforms. No visible GFP::EFA-6 due to ju1903 deletion. Reference: Sandhu A., et al. Cell Reports 2024 Oct 22;43(10):114776. doi: 10.1016/j.celrep.2024.114776. PMID: 39305484.
|
|
| CZ29114 |
C. elegans |
bli-6(ju1914[bli-6::mNG::3xFLAG]) IV. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-6 locus using Dickinson method. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
|
|
| CZ29326 |
C. elegans |
col-12::mNG(ju1932) V. Show Description
mNG inserted at C-terminus of endogenous col-12 locus.
|
|
| CZ333 |
C. elegans |
juIs1 IV. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. GFP expression in presynaptic terminals of GABAergic DD and VD motor neurons and RME neurons. Maintain under normal conditions. Reference: Hallan SJ and Jin Y. Nature. 1998 Sep 3;395(6697):78-82.
|
|
| CZ4213 |
C. elegans |
mkk-4(ju91) X. Show Description
Suppressor of rpm-1.
|
|
| CZ4601 |
C. elegans |
syd-2(ju487) X. Show Description
ju487 is a gain-of-function allele of syd-2, changing Arg184 to Cys. Reference: Dai Y, et al. Nat Neurosci. 2006 Dec;9(12):1479-87. doi: 10.1038/nn1808. PMID: 17115037.
|
|
| CZ5730 |
C. elegans |
dlk-1(ju476) I. Show Description
Suppressor of rpm-1.
|
|
| CZ7575 |
C. elegans |
ebax-1(ju699) IV; juEx1434. Show Description
juEx1434 [rgef-1p::ebax-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. juEx1434 rescues Egl of pqn-55(ju699) mutants. Reference: Wang Z., et al. Neuron. 2013 Sep 4;79(5):903-16.
|
|
| CZ9676 |
C. elegans |
acr-2(n2595 n2420) X. Show Description
Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.
|
|
| DA1084 |
C. elegans |
egl-30(ad806) I. Show Description
Egl. Semi-dominant suppressor of eat-11.
|
|
| DA1116 |
C. elegans |
eat-2(ad1116) II. Show Description
Eat. Slow pumping. Long lived. Embryonic lethality observed in a significant fraction of animals is likely explained by a mutation in an essential gene linked to eat-2
|
|
| DA1316 |
C. elegans |
avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. Show Description
Highly resistant to ivermectin. This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC. Received new stock 5/21/08. [NOTE: The correct genotype of this strain is avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-14(ad1302) I; avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC.]
|
|
| DA1370 |
C. elegans |
avr-15(vu227) glc-1(pk54) V. Show Description
Lacks M3 spikes. glc-1(pk54::Tc1). This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC. Received new stock 5/21/08. [NOTE: The correct genotype of this strain is avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC.]
|
|
| DA1384 |
C. elegans |
avr-14(ad1302) I; glc-1(pk54) V. Show Description
glc-1(pk54::Tc1). High level of ivermectin resistance. This strain cannot be sent to commercial recipients without approval from UT Southwestern. Do not distribute this strain; other labs should request it from the CGC.
|
|
| DA1426 |
C. elegans |
exp-2(sa26ad1426) V. Show Description
Reversion of sa26. Severely reduced R spikes, long pumps, short hold-backs.
|
|
| DA1674 |
C. elegans |
acr-19(ad1674) I. Show Description
Deletion of bp 1108-3194 of C31H5.3
|
|
| DA1750 |
C. elegans |
adEx1750. Show Description
adEx1750 [pmk-3::GFP + rol-6(su1006)]. Pick Rollers to maintain. Nuclear GFP in anterior and posterior intestine. [NOTE: adEx1750 contains a F42G8.4::GFP reporter construct. This array had been previously described as carrying a pmk-1::GFP reporter; the description of the array was updated in CGC records ~2016. islo-1, pmk-3, pmk-2, and pmk-1 are in an operon. The order of genes was described in Berman et al. as [pmk-1(F42G8.4)->pmk-2(F42G8.3)->pmk-3(B0218.3)], but the official WormBase gene names were assigned in reverse order [pmk-1(B0218.3)->pmk-2(F42G8.3)->pmk-3(F42G8.4)]. See Berman K, et al. Mol Cell Biol Res Commun. 2001 Nov;4(6):337-44. PMID: 11703092 for additional information.]
|
|
| DA1774 |
C. elegans |
ser-3(ad1774) I. Show Description
Deletion of bp 433-1994 of K02F2.6.
|
|
| DA1877 |
Comamonas sp. |
Comamonas sp. Show Description
Bacteria. Comamonas sp., a bacterium on which C. elegans grows particularly well. Str-R. DA1877 is derived from a bacterium isolated from soil in the Dallas area by Boris Shtonda in 2002. That strain was called H39 in Avery, L, Shtonda, BB (2003), "Food transport in the C elegans pharynx", J Exp Biol 206: 2441-2457. It was identified as genus Comamonas by 16S rDNA sequencing, as described in the paper. L. Avery isolated a spontaneous streptomycin-resistant variant by selecting for growth in LB broth + 200 ug/ml streptomycin sulfate. This strain, when spread on NGMSR plates, gave rise to faster-growing papillae; one of these was streaked out to get DA1877. Biosafety Level: BSL-1.
|
|
| DA1880 |
Bacillus megaterium |
Bacillus megaterium. Show Description
Bacteria. Str-R. L10 papilla 2; sporulation-defective mutant. This is a low-quality food that is difficult for the worms to eat, and is useful for studies of the effect of food on behavior, physiology, etc. [NOTE: This strain grows better on NGM than on LB media in CGC.] Described in J Exp Biol 206: 2441-2457. Biosafety Level: BSL-1.
|
|
| DA2100 |
C. elegans |
ser-7(tm1325) X. Show Description
Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.
|
|
| DA2143 |
C. elegans |
egl-4(ks62) IV; adEx2143. Show Description
adEx2143 [tax-4p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. pkg-1 is the new name of egl-4. Reference: You et al (2008) Cell Metab 7(3):249-57.
|
|
| DA2211 |
Escherichia coli |
E. coli. Show Description
Bacteria. E18 eat-4 promoter/GFP translational fusion, fused Klenowed ScaI/PstI fragments of pRE4-4-YK-Sac_Pst (~4.4kb) with TU#62(~2.2kb), checked loss of PstI site. PKA pRE4-GFP. Biosafety Level: BSL-1.
|
|
| DA472 |
C. elegans |
pha-2(ad472) X. Show Description
Misshapen pharynx; worms hatch with pharynx of correct gross shape, but disorganized, with nuclei misplaced. Most homozygotes arrest in L1, escapers grow up to become very starved adults with deformed pharynges with abnormally small terminal bulb, thick nucleated isthmus. Weakly cold sensitive. Makes dauers that don't recover; doesn't survive freezing well.
|
|
| DA509 |
C. elegans |
unc-31(e928) IV. Show Description
Extensively backcrossed to N2. Background strain for most of the feeding-defective mutant screens.
|
|
| DA702 |
C. elegans |
eat-16(ad702) I. Show Description
Note: ad702 was isolated in an RC301 background. DA702 was not tested for the presence of npr-1(g320) following three rounds of outcrossing to N2 Bristol. DA702 does not display clumping behavior, so it's likely that DA702 has the Bristol npr-1. New stock rec'd 10/13/99.
|
|
| DA810 |
C. elegans |
egl-30(ad810) gpb-2(ad541)/gpb-2(ad541) I. Show Description
ad810 is homozygous lethal. ad810/+ is Egl and it suppresses gpb-2. gpb-2 phenotype is rather subtle: they are slightly starved, slightly longer than normal, and tend to be loopy in their movements (they make abnormally deep bends). Hets should be Egl and non-Eat. On most E. coli strains gpb-2 grows rather poorly, especially if the plates are older so that there is a thick and tough lawn. On such plates there will be a lot of gpb-2 larval arrest, and those that don't arrest will grow slowly. The hets should easily outgrow the gpb-2 homozygotes. [gpb-2 is also hypersensitive to the drug arecoline: they won't grow on 5 mM. The hets will grow even better than WT on 5 mM arecoline.] gpb-2(ad541) previously called eat-11(ad541).
|
|
| DA823 |
C. elegans |
egl-30(ad805) I. Show Description
Suppressor of gpb-2 (a.k.a. eat-11) arecoline hypersensitivity. Unc. Egl.
|
|
| DC1 |
C. elegans |
bah-1(br1) I. Show Description
Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Fragile cuticle (mild): increased sensitivity to alkaline-hypochlorite.
|
|
| DC1079 |
C. elegans |
ces-1(n703) qDf8/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
|
|
| DC7 |
C. elegans |
bah-2(br7) IV. Show Description
Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Fragile cuticle (mild): increased sensitivity to alkaline-hypochlorite.
|
|
| DC9 |
C. elegans |
bah-3(br9) I. Show Description
Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Cld: constitutive larval display of epitope recognized by monoclonal antibody M37.
|
|
| DCD179 |
C. elegans |
uqEx37. Show Description
uqEx37 [kin-19p::kin-19::Venus + unc-122p::GFP]. Age-dependent aggregation of KIN-19::Venus in pharynx.
|
|
| DCD214 |
C. elegans |
uqIs24. Show Description
uqIs24 [myo-2p::tagRFP::pab-1]. Expression of tagRFP::PAB-1 in pharyngeal muscles; assembles into stress granules after heat shock (2 hr at 32C) and forms tagRFP::PAB-1 aggregates with age at 20C. Valuable marker for aging and for studying the aggregation of RNA-binding proteins with prion-like domains. Reference: Lechler MC, et al. Cell Rep. 2017 Jan 10;18(2):454-467.
|
|
| DCD23 |
C. elegans |
uqIs5. Show Description
uqIs5 [lbp-2p::lbp-2::TagRFP]. Age-dependent aggregation of LBP-2::TagRFP in the pseudocoelom. Reference: Gallotta I, et al.
Nature. 2020 Jul 8. doi: 10.1038/s41586-020-2461-z.
|
|
| DCL569 |
C. elegans |
mkcSi13 II; rde-1(mkc36) V. Show Description
mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II. Germline rescue of the rde-1(mkc36) indel mutation, allowing germline-specific RNAi. Reference: Zou L, et al. Scientific Reports Volume 9, Article number: 2354 (2019) "Construction of a germline-specific RNAi tool in C. elegans."
|
|
| DCR1337 |
C. elegans |
nsIs105 I; cima-1(wy84) IV; wyIs45 X; olaEx805. Show Description
nsIs105 [hlh-17p::GFP] I. wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx805 [hlh-17p::caspase12 + hlh-17p::caspase17 + ttx-3p::mCherry + glr-3p::mCherry + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Ablation of CEPsh glia partially suppresses AIY presynaptic maintenance defects in cima-1(wy84) mutants. nsIs105 (hlh-17::GFP) expression labels CEPsh glia. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1690 |
C. elegans |
cima-1(wy84) IV; egl-15(n484) wyIs45 X; olaEx1004. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1004 [F25B3.3p::egl-15(5A) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1004 does not rescue egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1710 |
C. elegans |
cima-1(wy84) IV; egl-15(n484) wyIs45 X; olaEx1015. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1015 [dpy-7p::egl-15(5A) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1015 rescues egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR1779 |
C. elegans |
cima-1(wy84) IV; egl-15(n484) wyIs45 X; olaEx1054. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1054 [dpy-7p::egl-15(5A)(ecto) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1054 rescues egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
|
|
| DCR3791 |
C. elegans |
pfk-1.1(ola72) X. Show Description
Diffuse distribution of synaptic vesicle markers (SNB-1, CAT-1, and RAB-3) under hypoxic conditions. pfk-1.1(ola72) causes C562Y missense mutation. Reference: Jang et al. Neuron. 2016 Apr 20;90(2):278-91.
|
|
| DCR4521 |
C. elegans |
atg-9(ola274[atg-9::gfp]) V. Show Description
This endogenous tag on ATG-9 was made from a CRISPR event that used a method described by Dickinson et al. 2015 to efficiently insert GFP in replace of the stop codon of atg-9. Reference: Stavoe AK, et al. Dev Cell. 2016 Jul 25;38(2):171-85.
|
|
| DCR4750 |
C. elegans |
olaIs35 X. Show Description
olaIs35 [ttx-3Gp::eGFP::lgg-1 + ttx-3Gp::mCherry + unc-122p::RFP]. Integrated transgene allows visualization of autophagosomes in a single neuron (AIY). "ttx-3G" refers to genomic fragment containing AIY motif described in Bertrand & Hobert Dev Cell. 2009 Apr;16(4):563-75. References: Stavoe AK, et al. Dev Cell. 2016 Jul 25;38(2):171-85. Hill SE, et al. Dev Cell. 2019 Mar 8. pii: S1534-5807(19)30104-2.
|
|
| DCR5765 |
C. elegans |
atg-4.2(ola316) IV. Show Description
Dominant negative allele of autophagy protease atg-4.2. Animals appear slightly dumpy. In neurons, autophagic vacuoles accumulate abnormally in the soma. Reference: Hill SE, et al. Dev Cell. 2019 Mar 8. pii: S1534-5807(19)30104-2.
|
|
| DCR8881 |
C elegans |
olaEx5329. Show Description
olaEx5329 [rab-3p::HYlight + elt-7p::mCherry]. Pick mCherry+ animals to maintain. Pan-neuronal expression of HYlight, a codon-optimized biosensor that responds to changing levels of FBP in cells. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527.
|
|
| DCR8892 |
C elegans |
olaEx5331. Show Description
olaEx5331 [rab-3p::HYlight-RA + elt-7p::mCherry]. Pick mCherry+ animals to maintain. Pan-neuronal expression of HYlight-RA, a reduced affinity version of the FBP biosensor that does not respond to changes in concentration of the FBP metabolite during hypoxia in vivo. Can be used as a negative control for HYlight sensor in strain DCR8881. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527.
|
|
| DCR9089 |
C elegans |
olaIs138 IV. Show Description
olaIs138 [ttx-3p::SL2::HYlight::let-858 3'UTR + elt-7p::mCherry] IV. Expression of HYlight, a codon-optimized biosensor that responds to changing levels of FBP in cells, in the neuron pair AIY. Derived by UV/TMP insertion of the olaEx5367 transgene. Reference: Wolfe AD, et al. Proc Natl Acad Sci U S A. 2024 Jan 16;121(3):e2314699121. doi: 10.1073/pnas.2314699121. PMID: 38198527.
|
|
| DDP1 |
C. elegans |
uonEx1. Show Description
uonEx1 [unc-54::alpha-synuclein::CFP + unc-54::alpha-synuclein::YFP(Venus)]. Pick fluorescent animals to maintain. No additional transformation marker was included in the array. uonEx1 also known as SC+SV in reference publications. Reduced lifespan (25-35% lower) and reduced pharyngeal pumping rate compared to N2. Novel transgenic strain for monitoring the influence of genetic and/or environmental factors on the extent of alpha-synuclein aggregation using FRET signals. Because the two fusion proteins are separate, FRET is only possible when synuclein aggregation brings a CFP tag very close to a YFP tag within an aggregate. We suggest using this strain in conjunction with the positive control (high FRET) strain DDP2 or with strain NL5901 which shows opposite changes in FRET. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.
|
|
| DDP2 |
C. elegans |
uonEx2. Show Description
uonEx2 [unc-54::CFP::YFP(Venus)]. No additional transformation marker was included in the array. uonEx2 also known as CV in reference publications. Lifespan and pharyngeal pumping rates are similar to N2. This is a high-FRET positive control strain for use in conjunction with DDP1. Because the CFP and YFP protein sequences are covalently fused together (and show little evidence of cleavage), FRET should be high and largely invariant since both fluorescent moieties are always in close proximity. References: Nagarajan A, et al. CNS Neurol Disord Drug Targets. 2015 Aug 21. Bodhicharla R, et al. CNS Neurol Disord Drug Targets. 2012 Dec;11(8):965-75.
|
|