Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CB113 C. elegans unc-17(e113) IV. Show Description
Unc, coiler. Lannate sensitive.
CB7427 C. elegans unc-17(e245) IV; eEx849. Show Description
eEx849 [C28H8.4(sdmV186E)]. unc-17 missense mutant suppressed by missense C28H8.4 transgene. Pick non-Unc hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation).
CB933 C. elegans unc-17(e245) IV. Show Description
M-MATING-NO SUCCESS. UNC-Severe coiler at all stages-small and thin. SCORED EASILY. Suppressed by sup-1, sup-2, and snb-1. Resistant to lannate. See also CGC 1770.
LX929 C. elegans vsIs48. Show Description
vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons.
OH15568 C. elegans unc-17(ot907[unc-17::mKate2::3xflag]) IV. Show Description
Superficially wild-type. mKate2 and 3xFlag tag added to endogenous unc-17 locus. unc-17::mKate2 labels all cholinergic neurons in the nervous system. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078.
RM523 C. elegans unc-17(cn355) IV. Show Description
cn355 behaves like other unc-17 hypomorphs (coily Unc, slow growth, aldicarb-resistant, etc.); however, the mutation is in the splice site necessary for generating unc-17 transcripts, so that unc-17 transcripts and UNC-17 protein are dramatically reduced (hence the unc-17 behavioral phenotypes), and the cha-1 transcripts, CHA-1 protein, and ChAT enzyme activity are significantly increased (Mathews et al., 2015). Note: UNC-17 and CHA-1 protein sequences are both completely wild-type; the phenotypes derive from the extremely low level of the (wild-type) UNC-17 protein. Flanking Sequences: AAATTTAGAAAAAATAAAATATTCC/ A>G /GGGGGAGAGAGAGAGATGGGCTTCA (in direction of transcription). Reference: Mathews EA, et al. Genetics. 2015 Mar;199(3):729-37.
RM580 C. elegans unc-17(md1447) IV. Show Description
md1447 is a spontaneous 465-bp deletion (with a 2-bp insertion) within the unc-17 3'UTR in a TR638 background. Protein level by immunostaining is barely detectible , but unc-17 behavioral phenotypes are relatively mild. Sequence details (in direction of transcription): TCGTAGATTTGGATCTCTGAATATG/Ä465+AA/AGTGATTTCGTATAGAGTAATGTCA . This allele is the only smg-suppressible allele of unc-17 reported thus far. Since the md1447 deletion is entirely within the unc-17 3'UTR, the amino acid sequence of the UNC-17 protein is completely wild-type. Therefore the phenotype derives from the nonsense-mediated decay of the transcript which in turn leads to an extremely low level of wild-type UNC-17 protein (see figure on following page). Many other unc-17 alleles have reduced immunoreactivity (but more immunoreactivity than md1447) yet significantly stronger behavioral phenotypes than md1447. Therefore, the behavioral phenotypes of these other alleles are not due to reduced transporter. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM908 C. elegans unc-17(e245) IV. Show Description
Small, slow-growing, coily uncoordinated, jerky going backward, aldicarb- and lannate-resistant. Molecular details: G347R (gga>>aga) in the 9th transmembrane domain of the UNC-17 protein. PCR method for scoring the e245 mutation in individual worms is presented in the Supporting Information File of Mathews et al., 2012.
AG166 C. elegans mdf-2(av16) unc-17(e245) IV. Show Description
Reduced brood size. Reduced hatching. Slow growth. Larval lethal. Larval arrest. Bursts at vulva. Suppresses the mat-3 one-cell arrest at 25C.
CB1893 C. elegans unc-17(e113) dpy-13(e184) IV. Show Description
DpyUnc. e184 is semi-dominant.
CB2110 C. elegans unc-17(e245) IV; sup-2(e997) X. Show Description
Suppressed Unc. Movement almost WT.
CB3031 C. elegans unc-17(e245) IV; snb-1(e1563) V. Show Description
Dominant suppressor of Unc. Movement almost WT.
CB7430 C. elegans unc-17(e245) IV; eEx855. Show Description
eEx855 [erd-2(sdmV186E) + sur-5p::GFP]. unc-17 missense mutant partly suppressed by missense erd-2 (a.k.a. sup-2) transgene. Pick GFP+ (weak Unc) hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation).
DR105 C. elegans unc-17(e245) dpy-20(e1282) IV. Show Description
DpyUnc.
KW1973 C. elegans taf-6.2(ax701) unc-17(e113) IV. Show Description
Unc. Maintain at 15C. Temperature-sensitive Emb when L4 larvae are shifted to restrictive temperature (25C). L1 larvae shifted to restrictive temperature arrest and die as young larvae. Reference: Bowman EA, et al. Worm Breeder's Gazette 2011 18(4).
KW1975 C. elegans taf-6.2(ax514) unc-17(e113) IV. Show Description
Unc. Maintain at 15C. Temperature-sensitive Emb when L4 larvae are shifted to restrictive temperature (25C). L1 larvae shifted to restrictive temperature arrest and die as young larvae. Reference: Bowman EA, et al. Worm Breeder's Gazette 2011 18(4).
MT628 C. elegans dpy-9(e12) unc-17(e245) IV. Show Description
Dpy. Unc.
RM3643 C. elegans sup-1(e995 e2636) III; unc-17(e245) IV. Show Description
Indistinguishable from unc-17(e245) single mutants (small, slow-growing, coily uncoordinated, jerky going backward, aldicarb-resistant). For additional information, see descriptions of the RM908 unc-17(e245) IV and RM3671 sup-1(e995 e2636)) III single mutant strains. PCR methods for scoring e245, e995, and e2636 mutations in individual worms are presented in the Supporting Information File of Mathews et al., 2012. Derived by crossing RM908 (6x outcrossed) and RM3571 (6x outcrossed). Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM3645 C. elegans unc-17(e245) IV; snb-1(e1563) V. Show Description
Almost full suppression of all unc-17 mutant phenotypes; animals are superficially wild type in appearance, development, and behavior, and males mate well. For additional information, see descriptions of the RM908 unc-17(e245) IV and the RM3659 snb-1(e1563) V single mutant strains. Reference: Sandoval GM, et al. Nat Neurosci. 2006 May;9(5):599-601.
RM3660 C. elegans sup-1(e995) III; unc-17(e245) IV. Show Description
Almost full suppression of all unc-17 mutant phenotypes; animals are superficially wild type in appearance, development, and behavior, and males mate well. For additional information, see descriptions of the RM908 unc-17(e245) IV and the RM3670 sup-1(e995) III single mutant strains. PCR methods for scoring e245 and e995 mutations in individual worms are presented in the Supporting Information File of Mathews et al., 2012. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.
RM969 C. elegans smg-1(md7) I; unc-17(md1447) IV. Show Description
Approximately wild-type for the unc-17 phenotypes; displays typical smg-1 phenotypes (protruding vulvae, defective male tails, poor male mating).
XA4828 C. elegans unc-13(e1091) I; unc-17(e327) IV. Show Description
Previously called MA1128.
DR907 C. elegans unc-17(e113) dpy-13(e184) IV; mDp1 (IV;f). Show Description
Animals which carry the Dup are semi-Dpy and segregate semi-Dpy and DpyUnc (animals which have lost the Dup). Animals homozygous for the Dup are slow growing, slender and transparent. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
EM141 C. elegans unc-17(e113) col-34(bx25) IV; him-5(e1490) V. Show Description
Unc. Abnormal rays. bx25 previously called ram-4.
MT4150 C. elegans unc-17(e245) dpy-4(e1166) IV; him-5(e1490) V. Show Description
DpyUnc. Segregates males.
CB5265 C. elegans sup-1(e995e2636) III; unc-17(e245) IV; xol-1(y9) X. Show Description
Severely uncoordinated coiler, slow growing. Useful strain for selecting non-Sup-1 suppressors of unc-17(e245). Reference: Mathews et al. (2012) PMID: 23051648.
DR1786 C. elegans dpy-13(e184) unc-24(e138) IV; mDp4[unc-17(e245)] (IV;?). Show Description
WT phenotype. Segregates WT and DpyUncs. mDp4 carries dpy-13(+) and unc-24(+). Duplication may recombine with normal homologues. Presence of unc-17(e245) on mDp4 confirmed: got Unc-17 segregants after heat shock of this stock to generate males. Pick WT and check for segregation of progeny to maintain.
DR690 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-272(m243) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLet.
DR691 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-287(m244) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are sterile adults. Maintain by picking semi-Dpy.
DR692 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-275(m245) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. Lethal mid-larval. Maintain by picking semi-Dpy.
DR694 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-281(m247) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
DR695 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-285(m248) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adult steriles. Maintain by picking semi-Dpy.
DR703 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-274(m256) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. Lethal early larval. Maintain by picking semi-Dpy.
DR705 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-282(m258) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
DR706 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-280(m259) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
DR709 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-279(m261) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
DR710 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-277(m262) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpys, Uncs and Lets. Lethal mid-larval. Maintain by picking semi-Dpy.
DR711 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-273(m263) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
DR715 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-284(m267) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
DR717 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-286(m269) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adults which lay eggs that do not hatch. Maintain by picking semi-Dpy.
DR767 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-288(m306) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. DpyLets are adult steriles. Maintain by picking semi-Dpy.
CB7550 C. elegans erd-2.1(e997) X. Show Description
Val186Glu. Null allele. Slightly cold-sensitive; dominant suppressor of unc-17(e245). Lethal with erd-2.2(RNAi). Also known as sup-2(e997). Reference: Mathews EA, et al. Genetics. 2021;218(4):iyab065. doi:10.1093/genetics/iyab0. PMID: 33914877.
DCR9211 C. elegans unc-17(ola503[unc-17::GFP FLP-on]) IV. Show Description
GFP FLP-on inserted at C-terminus of endogenous unc-17 locus. Part of SynaptoTagMe toolkit for examining cell-specific cholinergic transmission. See https://elifesciences.org/reviewed-preprints/108675 for sequencing information. Reference: Cuentas-Condori A, et al. bioRxiv 2025.08.18.670838; doi: https://doi.org/10.1101/2025.08.18.670838
DCR9265 C. elegans unc-17(syb7251[GFP::SL2::unc-17 FLP-on]) IV. Show Description
GFP::SL2 FLP-on inserted at N-terminus of endogenous unc-17 locus. Part of SynaptoTagMe toolkit for examining cell-specific cholinergic transmission. See https://elifesciences.org/reviewed-preprints/108675 for sequencing information. Reference: Cuentas-Condori A, et al. bioRxiv 2025.08.18.670838; doi: https://doi.org/10.1101/2025.08.18.670838
DCR9374 C. elegans unc-17(syb7882[unc-17::mRuby3 FLP-on]) IV. Show Description
mRuby3 FLP-on inserted at C-terminus of endogenous unc-17 locus. Part of SynaptoTagMe toolkit for examining cell-specific cholinergic transmission. See https://elifesciences.org/reviewed-preprints/108675 for sequencing information. Reference: Cuentas-Condori A, et al. bioRxiv 2025.08.18.670838; doi: https://doi.org/10.1101/2025.08.18.670838
ER50 C. elegans unc-123(jd5jd10) III. Show Description
Recessive suppressor of unc-123(jd5). Exhibits a subtle dorsal asymmetric locomotory defect as a homozygote when grown at 25C. Dominant suppressor of unc-17(e245). Most likely unc-123 is allelic with sup-1.
FX17650 C. elegans lin-1(tm5929)/tmIn1 IV. Show Description
Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(egl-4 unc-17) IV. Covered region (Mb) 1.8 (1.8..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
FX19059 C. elegans Y38F2AR.9(tm1986)/tmIn3 IV. Show Description
Homozygous lethal deletion allele balanced by Unc-marked translocation. Pick wild-type to maintain. Heterozygotes are wild-type and segregate wild-type (heterozygotes), Let (tm1986 homozygotes), and larval arrest (tmIn3 homozygotes). Break points: In(jtr-1 unc-17) IV. Covered region (Mb) 2.2 (1.4..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
FX19163 C. elegans mca-3(tm6395)/tmIn11 IV. Show Description
Homozygous lethal deletion allele balanced by Unc-marked translocation. Heterozygotes are wild-type and segregate wild-type heterozygotes, lethal tm6395 homozygotes, and Unc tmIn11 homozygotes. Break points: In(kvs-5 unc-17) IV. Covered region (Mb) 2.9 (0.7..3.6) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19170 C. elegans lin-1(tm5929)/tmIn2 IV. Show Description
Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(ced-2 unc-17) IV. Covered region (Mb) 2 (1.6..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.