Strain Information
| Name | DV3089 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | rheb-1(re64[mKate2::3xFlag::rheb-1]) III. |
| Description | mKate tag inserted at 5' end of endogenous rheb-1 locus. Ubiquitous expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. Reference: Duong T, et al. Development. 2020 Mar 2;147(5):dev181727. doi: 10.1242/dev.181727. PMID: 32041790. |
| Mutagen | CRISPR |
| Outcrossed | x3 |
| Made by | Tam Duong |
| Laboratory | DV |
| Reference | Duong et al, submitted |
Sign in
or
register an account if you want to order this strain.