| DE115 |
C. elegans |
dnSi8 I; unc-119(ed3) III; dnIs22. Show Description
dnSi8 [tdp1::flag::mCherry + Cbr-unc119(+)] inserted into ttTi5605 on LG II. Nuclear-localized mCherry. dnIs22 [sup-46::GFP + unc-119(+)] (site of integration unknown). Strong nuclear-localized GFP expression. [NOTE: This strain was produced by crossing two parental strains carrying strong unc-119 loss of function alleles. One parent was carrying ed3; the allele in the other parental strain is unknown.]
|
|
| DE12 |
C. elegans |
sup-46(qa710) I. Show Description
Superficially WT. Suppressor of gna-2. Reduced brood counts at all temperatures (very strongly reduced at 26C). Exhibits mating-dependent progressive hermaphrodite sterility. Reduced embryo survival following heat shock.
|
|
| DE130 |
C. elegans |
unc-119(e2488) III; dnIs24. Show Description
dnIs24 [sup46::flag::mCherry + Cbr-unc-119(+)]; site of integration unknown. Strong nuclear-localized mCherry.
|
|
| DF5012 |
Rhomborhabditis regina |
Rhomborhabditis regina wild isolate. Show Description
0012. Male/Female strain. Isolated by M. Velasquez in the spring of 1989 from a June beetle larva (Scarabaeidae) near Quetzaltenango, Guatemala. WBG 12(5) 14. Formerly known as Rhabditoides regina.
|
|
| DF5017 |
Mesorhabditis longespiculosa |
Show Description
WT strain. Mesorhabditis longespiculosa. Isolated by W. Sudhaus on August 16, 1973 from tunnels of beetle larvae (Mallodon downesi?, Cerambycidae) in Euphorbiaceae at lake Nakuru, Kenya. See WBG 12(5) 14. Male/Female strain.
|
|
| DF5022 |
Pelodera strongyloides |
Show Description
WT strain, Pelodera strongyloides. Isolated in April 1948 from pustules in the skin of a cow with dermatitis in central Illinois (see Levine et al 1950). Gonochoristic. May cause dermatitis in mammals (such as domesticated animals, and, rarely, humans). Grows well at 16-24C on OP50. Dauer larvae are the infective stage and are thermotactic. Freezes easily with C. elegans protocols with 70% viability. Previously called Pelodera strongyloides dermatitica by the CGC.
|
|
| DF5025 |
Reiterina typica |
Reiterina typica wild isolate. Show Description
WT strain. Rhabditis (Pellioditis) typica. Male/Female strain. Isolated by W. Sudhaus on Sept. 3, 1973 from feces of an antelope in Tsavo National Park, Kenya. See WBG 12(5) 14. Formerly known as Rhabditis (Pellioditis) typica.
|
|
| DF5081 |
C. japonica |
Caenorhabditis japonica. Show Description
Male-female strain. Maintain by mating. Strain used for sequencing. DF5081 is the strain of Caenorhabditis japonica that Karin Kiontke generated with 20x incrossing of DF5080. http://genome.wustl.edu/pub/organism/Invertebrates/Caenorha bditis_japonica/assembly/Caenorhabditis_japonica-3.0.2/ASSE MBLY
|
|
| DF5152 |
C. sp. 30 |
Show Description
Isofemale line. Isolated from a rotten lemon collected at Chan Chich Lodge in the town of Gallon Jug, Orange Walk, Belize (17.56399°N, 89.046282°W) on 11/15/12.
|
|
| DF64 |
C. elegans |
nyDf1(ny15) IV; him-5(e1490) V. Show Description
Deficiency covers at least all of cosmid T23G4; right breakpoint may be in cosmid C47A4. Fails to complement tlp-1(bx85). Viable and fertile. Although hermaphrodites appear WT in other ways, there are some problems with T cell lineages (affecting the phasmids) and tail cell fusions. Variably Dyf. Male tail tip morphogenesis is also defective, resulting in blobby, "leptoderan" tails. Males are infertile due to an inability to properly copulate.
|
|
| DG1770 |
C. elegans |
cgh-1(ok492) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C07H6.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok492 homozygotes (sterile adult, tends to explode at vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCAGCTCGAAAATATTGCC. External right primer: GGAAAACCGCAAGGATGGTGG. Internal left primer: TCACGGAGCTAGATGTGACG. Internal right primer: CGTCAAAAAGAACCCGATGT. Internal WT amplicon: 3095 bp. Deletion size: 1043 bp. Deletion left flank: GAGAACATACACAATCTGGACGAGATCACT. Deletion right flank: CCTGGGGTGGCGATGACCAAGTGAACCGTT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
|
|
| DG1856 |
C. elegans |
goa-1(sa734) I. Show Description
Recessive, early stop mutation within the coding sequence (C to T substitution in aa52) makes sa734 a likely null allele. May grow slightly better at 15C. Hyperactive, lays early stage eggs, increased amplitude of locomotory wave-form. Suppresses the lethargy and egg-laying defects of unc-43(n498). Reverses direction of locomotion more frequently than WT.
|
|
| DG2913 |
C. elegans |
egl-30(ad810) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ad810 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
| DG3887 |
C. elegans |
inx-21(tn1540) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (inx-21(tn1540) homozygous animals are sterile, producing few germ cells). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Starich TA, Hall DH, Greenstein D. Genetics. 2014 Nov;198(3):1127-53.
|
|
| DG4153 |
C. elegans |
pod-2(tn1691) II; tnEx212. Show Description
tnEx212 [pod-2(+) + sur-5::GFP]. Pick GFP+ animals to maintain. sur-5::gfp(+) animals are wild type and segregate GFP(+) wild-type animals and GFP(-) pod-2(tn1691) dead embryos. tn1691 deletes ~15 kb within pod-2, including most of Exon 2 through to and including the stop codon (but not the polyA site). Reference: Starich TA, et al. eLife 2020;9:e58619 DOI: 10.7554/eLife.58619 PMID: 32735213
|
|
| DG4218 |
C. elegans |
cpg-1(tn1728[mNG::3xflag::cpg-1]) III. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous cpg-1 locus. Superficially wild type.
|
|
| DG4329 |
C. elegans |
fasn-1(tn1762) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP heterozygotes, arrested hT2 aneuploids, and non-GFP tn1762 homozygotes (dead embryos and L1 larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. tn1762 is a ~9.2 kb deletion within fasn-1, including Exon 2 thru to 57 nt preceding stop codon. Reference: Starich TA, et al. eLife 2020;9:e58619 DOI: 10.7554/eLife.58619 PMID: 32735213
|
|
| DG4454 |
C. elegans |
npp-12(ok2424) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) Show Description
Homozygous ok2424 animal are viable and fertile, but will go sterile in successive generations. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2424 homozygotes (superficially wild-type with some sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Derived from parental strain RB1874, originally provided to the CGC by the OMRF Knockout Group, part of the International C. elegans Gene Knockout Consortium. Paper_evidence WBPaper00041807
|
|
| DH1201 |
C. elegans |
rme-1(b1045) V. Show Description
Viable. Progressive vacuolation of intestine beginning in L4. Endocytosis defects in oocytes and coelomocytes.
|
|
| DH1300 |
C. briggsae |
C. briggsae wild isolate. Show Description
DH subclone of C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years, and has acquired mutations that have not been named or mapped. It is Unc, dauer-defective and ts lethal. Previously called C. briggsae BO. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| DH1370 |
C. elegans |
rme-6(b1014) X. Show Description
Accumulation of yolk GFP in pseudocoelom suggesting decrease or absence of coelomocyte mediated endocytosis. Abundant pseudocoelomic yolk.
|
|
| DH1390 |
C. elegans |
rme-2(b1008) IV. Show Description
Low brood size and incompletely penetrant embryonic lethality. Accumulates yolk in the pseudocoelom of adult hermaphrodites. Males are normal.
|
|
| DLM16 |
C. elegans |
ubc-18(tm5426) sup-35(e2215) pha-1(e2123) III. Show Description
sup-35 rescues synthetic lethality of ubc-18 and pha-1.
|
|
| DLM17 |
C. elegans |
pha-1(e2123) III; sup-36(e2217) IV. Show Description
Superficially wild-type. sup-36 suppresses temperature-sensitive lethality of pha-1(e2123). Constructed by crossing GE24 and MT14541.
|
|
| DLM18 |
C. elegans |
ubc-18(tm5426) III; sup-36(e2217) IV. Show Description
sup-36 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.
|
|
| DLM19 |
C. elegans |
ubc-18(tm5426) III; sup-37(e2215) V. Show Description
DLM 19: sup-37 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.
|
|
| DLM25 |
C. elegans |
hif-1(ia4) V; otIs197. Show Description
otIs197 [unc-14p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. otIs197 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| DLM26 |
C. elegans |
hif-1(ia4) V; otEx3165. Show Description
otEx3165 [unc-120p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from muscle-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. otEx3165 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| DLW109 |
C. elegans |
wrdSi23 I; unc-104(knu973[unc-104::AID*]) II. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| DLW110 |
C. elegans |
wrdSi23 I; unc-18(knu969[unc-18::AID*]) X. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| DLW112 |
C. elegans |
reSi7 I; unc-104(knu973[unc-104::AID*]) II. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID*-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| DLW114 |
C. elegans |
reSi7 I; unc-18(knu969[unc-18::AID*]) X. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID*-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID* into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| DLW124 |
C. elegans |
wrdSi22 I; unc-52(knu968[AID*::unc-52]) II. Show Description
wrdSi22 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
| DLW14 |
C. elegans |
unc-5(lib1[myo-3p::GFP(-) + unc-119(+) + myo-2p::GFP(Mos1)]) IV; krIs14 V. Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008
|
|
| DM1017 |
C. elegans |
unc-52(e3003e998) II; ccar-1(ra5) IV. Show Description
Suppressed Unc-52. This strain was isolated after EMS mutagenesis of CB998 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to the unc-52 and sup-38 mutations, it is homozygous for 300 other mutations determined from sequence data. All mutations are annotated in WormBase. The e3003 and e998 mutations were present in the original CB998 strain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
|
|
| DM1153 |
C. elegans |
ccar-1(ra14) IV. Show Description
WT in appearance and movement. Some slight body wall muscle disorganization. More severe gonad disorganization, and greatly reduced brood size. Suppresses the e444, e998, 669, e1012, e1421 and st196 alleles of unc-52.
|
|
| DM1154 |
C. elegans |
ccar-1(ra5) IV. Show Description
WT in appearance and movement. Some slight body wall muscle disorganization. More severe gonad disorganization, and greatly reduced brood size. Suppresses the e444, e998, 669, e1012, e1421 and st196 alleles of unc-52.
|
|
| DM1208 |
C. elegans |
unc-112(r367ra202) V. Show Description
Intragenic revertant (ra202) of original unc-112 mutation. WBPaper 00005804.
|
|
| DM1245 |
C. elegans |
unc-112(r367) V; Y102F5A.1(ra238) dim-1(ra204) X. Show Description
Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
|
|
| DM1602 |
C. elegans |
hsp-1(ra807) IV; unc-23(e25) V. Show Description
Superficially wild-type. Temperature-sensistive. Maintain at 15C. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Animals are sterile or arrest development as larvae at when grown at 20-25C. Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.
|
|
| DM2407 |
C. elegans |
hsp-1(ra807) IV; dpy-11(e224) V. Show Description
Dpy. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.
|
|
| DM3007 |
C. elegans |
unc-112(r367) V; +/raDf7 X. Show Description
raDf7 suppresses the paralyzed phenotype of unc-112(r367) because the deficiency deletes the dim-1 gene. Reduction or loss of the dim-1 gene product suppresses the unc-112(r367) phenotype. In this strain: Animals homozygous for raDf7 arrest as L1 or L2 larvae; Animals without raDf7 are paralyzed as adults; Animals heterozygous for raDf7 move reasonably well.
|
|
| DM5115 |
C. elegans |
unc-112(st581) V; raEx16. Show Description
raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and rescues the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.
|
|
| DM5116 |
C. elegans |
unc-112(gk1)/unc-39(e257) V. Show Description
C47E8.7. Heterozygotes are WT and segregate WT, Pat unc-112 homozygotes and Unc homozygotes. Pick WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| DM5117 |
C. elegans |
unc-52(gk3) II. Show Description
ZC101.2a. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| DM7016 |
C. elegans |
raEx16. Show Description
raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and will rescue the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.
|
|
| DM7438 |
C. elegans |
+/mT1 II; pxl-1(ok1483)/mT1 [dpy-10(e128)] III; raEx438. Show Description
raEx438 [pxl-1p::pxl-1a(cDNA)::GFP + rol-6(su1086)]. Rollers. Transgene does not rescue ok1483 L1 lethality. Transgenic (Rol) heterozygotes segregate rolling non-Dpy (heterozygotes carrying raEx438), non-rolling non-Dpy (heterozygotes without the array), arrested L1 (ok1483 homozygotes) and sterlie Dpy (mT1 homozygotes). Pick rolling non-Dpy and check for correct segregation of progeny to maintain. Reference: Warner A, et al. Mol Biol Cell. 2011 Jul 15;22(14):2551-63.
|
|
| DM7439 |
C. elegans |
raEx151. Show Description
raEx151 [cpna-1::YFP + rol-6(su1006)]. GFP inserted into WRM0617dC02 fosmid at 3' end of cpna-1 gene. WRM0617dC02 fosmid with YFP inserted into the F31D5.3/cpna-1 gene in frame at its 3' end by recombineering. YFP expression in body wall muscle cells at dense bodies and M-lines; weak expression in the pharynx. Pick Rollers to maintain. Reference: Warner A, et al. Mol Biol Cell. 2013 Mar;24(5):601-16.
|
|
| DMS303 |
C. elegans |
nIs590 V. Show Description
nIs590 [fat-7p::fat-7::GFP + lin15(+)] V. Derived by X-ray integration of waEx15. The fat-7::fat-7::GFP translational reporter is activated by 15C or acdh-11 loss-of-function. See Ma et al., Cell. 2015 May 21; 161(5): 11521163.
|
|
| DMS441 |
C. elegans |
acdh-11(n5878) III; nIs590 V. Show Description
nIs590 [fat-7p::fat-7::GFP + lin15(+)] V. The fat-7::fat-7::GFP translational reporter is activated constitutively by loss of acdh-11 function. acdh-11(n5878) is a 366 bp deletion. Reference: Ma et al., Cell. 2015 May 21; 161(5): 11521163.
|
|