More Fields
Strain Species Genotype
BJS737 C. elegans mpk-1(sbj10) III. Show Description
Temperature sensitive allele of mpk-1, bypasses UV sensitivity of csb-1 mutant at 20-25C. Reference: Bianco JN & Schumacher B. Nucleic Acids Res. 2018 May 21. doi: 10.1093/nar/gky404.
DV3285 C. elegans his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
MH37 C. elegans mpk-1(ku1) unc-32(e189) III. Show Description
Unc. ku1 pka sur-1(ku1).
NL723 C. elegans mpk-1(pk79) mut-2(r459) I. Show Description
SD184 C. elegans unc-79(e1068) mpk-1(n2521) III. Show Description
Unc.
SD366 C. elegans mpk-1(n2521) III; let-60(n1046) IV. Show Description
Less than 5% Muv animals.
SD939 C. elegans mpk-1(ga111) unc-79(e1068) III. Show Description
Unc. Temperature-sensitive sterile. Maintain at 15C. NOTE: Lackenr & Kim (1998) incorrectly states that the ga111 mutant has a T to C transition. The transition is actually T to G giving rise to a Val148Gly substitution. Reference: Lackner MR & Kim SK. Genetics. 1998 Sep;150(1):103-17.
MT8186 C. elegans mpk-1(oz140)/dpy-17(e164) unc-79(e1068) III. Show Description
Heterozygotes are WT and segregate WT, Vul and DpyUncs. oz140 homozygotes are Vul and Sterile.
MT8388 C. elegans dpy-17(e164) mpk-1(oz140)/dpy-17(e164) unc-79(e1068) III. Show Description
Heterozygotes are Dpy and segregate Dpy, DpyUncs and DpyVulSterile. oz140 homozygotes are Vul and Sterile.
PJ1109 C. elegans mpk-1(n2521) III; let-60(ga89) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V.
PJ1114 C. elegans clr-1(e1745) II; mpk-1(n2521) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. clr-1 is termperature-sensitive.
SD378 C. elegans mpk-1(ga117)/dpy-17(e164) unc-79(e1068) III. Show Description
Heterozygotes are WT and segregate WT, Sterile Vuls, and Dpy Uncs.
SD415 C. elegans mpk-1(ga118)/dpy-17(e164) unc-79(e1068) III. Show Description
Heterozygotes are WT and segregate WT, Sterile Vuls, and Dpy Uncs.
SD420 C. elegans mpk-1(ga119)/dpy-17(e164) unc-79(e1068) III. Show Description
Heterozygotes are WT and segregate WT, Sterile Vuls, and Dpy Uncs.
BS3760 C. elegans rskn-1(ok159) I. Show Description
Ectopic ERK MPK-1 (detected by dpMPK-1 immunostaining) in the loop region. Reference: Proc Natl Acad Sci USA. Das D, et al. 2022 Jan 18;119(3):e2113649119. PMID: 35022236
GLW19 C. elegans mpk-1(utx14[mNG::mpk-1]) III. Show Description
Superficially wild-type. N-terminal tag of MPK-1 via CRISPR/Cas9 knock-in of mNeonGreen at mpk-1 locus. Insertion verified by PCR. Left flank: 5' tagaaatttaaaattcatttcttcttgcag 3'; Right flank: 5' ATGGCCGACGGAGAAGCGGTTATCTCGACG 3'. sgRNA: 5' ttcttcttgcagATGGCCGA 3'
GS8190 C. elegans arTi85. Show Description
arTi85 [lin-31p::ERK::KTR::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi85 transgene is a single-copy transposon insertion expressing a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
GS8255 C. elegans arTi101. Show Description
arTi101 [lin-31p::ERK::KTR(S43A, T55A, S62A)::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi101 transgene is a single-copy transposon insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Use arTi101 as a negative control for transgene arTi85. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
GS8729 C. elegans arSi12. Show Description
arSi12 [mex-5p::ERK::KTR::GFP(smu-1 introns)::T2A::mCherry::his-11::tbb-2 3'UTR]. arSi12 is a single-copy CRISPR/Cas9-engineered insertion expressing a fluorescent protein (ERK::KTR::GFP) that reports MPK-1 kinase activity in the germline. A nuclear histone marker is co-expressed (mCherry::H2B). Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
GS8752 C. elegans arSi15. Show Description
arSi15 [mex-5p::ERK::KTR(S43A, T55A, S62A)::GFP(smu-1 introns)::T2A::mCherry::his-11::tbb-2 3'UTR]. arSi15 is a single-copy CRISPR/Cas9-engineered insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::GFP) that reports MPK-1 kinase activity in the germline. A nuclear histone marker is co-expressed (mCherry::H2B). Use arSi15 as a negative control for transgene arSi12. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
JK6383 C. elegans mpk-1(q1147[V5::mpk-1B] q1183[mpk-1AB::2xOLLAS]) III. Show Description
Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
JK6403 C. elegans mpk-1(q1147[V5::mpk-1B] q1201[mpk-1B del] q1183[mpk-1AB::2xOLLAS])/qC1 [qIs56] III. Show Description
qIs56 [lag-2p::GFP + unc-119(+)]. q1201 is a 125 bp deletion causing a frameshift in mpk-1B without affected mpk-1A. Heterozygous animals Roll and have GFP+ distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes (sterile, but form a vulva). qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
JK6432 C. elegans mpk-1(q1190)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
Heterozygous animals Roll and have GFP(+) distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes which are sterile and vulvaless. qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. q1190 is a deletion in mpk-1 that removes 2221bp between axons 2-7 (based on mpk-1b annotation). Sequence is shared between mpk-1a and mpk-1b. The deletion is in frame and leaves 27bp of coding sequence.Reference: Robinson-Thiewes S, et al. Cell Rep. 2021 May 25;35(8):109162. doi: 10.1016/j.celrep.2021.109162.
PJ1115 C. elegans gaIs37 IV; ccIs55 V. Show Description
gaIs37 [Ef1a::Dmek hs::mpk-1] IV. ccIs55 [unc-54::lacZ + sup-7(st5)] V. At 20C, 99% of the worms are WT. At 25C, close to 100% of the worms are Muv. Also, a heat-shock at the L2 stage can produce a 80-90% Muv phenotype.
PJ1263 C. elegans gaIs37 IV; unc-51(e369) ccIs55 V. Show Description
gaIs37 [EF1a::Dmek + hs::mpk-1] IV. ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc. MuV with some frequency at 25C. Low frequency of tail defects at all temps. Appear more Dpy at 25C than 15C.
SD323 C. elegans gaEx40. Show Description
gaEx40 [hs-mpk-1(gf) + hs-dMEK(+) + rol-6(su1006)]. Maintain by picking Rollers.
UTR133 C. elegans narSi2 II; mpk-1(ga117) III; narEx29. Show Description
narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. narEx29 [sur-5p::GFP::mpk-1A + myo-3p::RFP]. mpk-1(-) strain with germline MPK-1B rescued by single-copy insertion and somatic MPK-1A rescued by an extrachromosomal array. Pick RFP+ to maintain; narEx29 rescues mpk-1 so array should be stable. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
UTR93 C. elegans narSi2 II; mpk-1(ga117) III. Show Description
narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. mpk-1(-) strain with germline-specific expression of GFP::MPK-1B. GFP::MPK-1B rescues fertility but the animals are still Vulvaless. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.