Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
DQM984 C. elegans bmdSi245 pbrm-1(st12226[pbrm-1::TY1::EGFP::3xFLAG]) I. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DV3089 C. elegans rheb-1(re64[mKate2::3xFlag::rheb-1]) III. Show Description
mKate tag inserted at 5' end of endogenous rheb-1 locus. Ubiquitous expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. Reference: Duong T, et al. Development. 2020 Mar 2;147(5):dev181727. doi: 10.1242/dev.181727. PMID: 32041790.
DV3285 C. elegans his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
DV3312 C. elegans rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. Show Description
Ubiquitous expression with cytosolic localization. Derived in an N2 background. Detection with triplex primers: HS125 5’-CTTGTCACTGTAAGGGAAGATTTCC-3’ HS126 5’-TTGTCCTCCTCTCCCTTGG-3’ HS127 5’ ACGTAGAATGTTCCAGAGTTCCAG-3' Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
DV3327 C. elegans pmk-1(re170[pmk-1::mNG::3xFlag]) IV. Show Description
mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
DV3402 C. elegans ral-1(re218[mKate2::3xFlag::ral-1]) III. Show Description
Ubiquitous expression and localization to plasma membranes. Derived in an N2 background. TD185 5’ -GCCGGAAGAGTGATGAACCC- 3’ TD186 5’ -TAATGAGCTCGGAGACCATGGC- 3’ TD187 5’ -CGCACCTCATCATACATGAACTGC- 3’ Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
DV3670 C. elegans rheb-1(re64 re285[AID*::mKate2::3xFlag::rheb-1]) III. Show Description
AID* tag in 5' end of mKate2-tagged endogenous rheb-1. Ubiquitous mKate2 expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. universal mKate2 site crRNA: catgttttctttaatgagct / insertion site in mKate2:gaagATGCCA....GGAGCATCGGGAGCCTCAGGAGCATCGATGGTCTCCGAGC^TCATTAAAGA. Reference: Fakieh R, et al. MicroPubl Biol. 2022 Aug 9:2022:10.17912/micropub.biology.000622. doi: 10.17912/micropub.biology.000622. PMID: 36035777.
DV4012 C. elegans rap-2(re346[mKate2::3xFLAG::rap-2]) V. Show Description
mKate2::3xFLAG tag inserted into endogenous rap-2 locus. Ubiquitous red expression, plasma membrane with some cytosolic localization. Reference: Fakieh RA & Reiner DJ. Proc Natl Acad Sci USA. 2025 Jan 7;122(1):e2414321121. doi: 10.1073/pnas.2414321121. PMID: 39739816.
DZ710 C. elegans fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II. Show Description
fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II.
DZ840 C. elegans tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.
DZ841 C. elegans tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
EGD615 C.elegans cox-4(zu476[cox-4::eGFP::3XFLAG]) I; egxSi136 II; unc-119(ed3) III. Show Description
egxSi136 [mex-5p::tomm-20::halotag::pie-1 3’UTR + unc-119(+)] II. GFP and 3xFLAG tags inserted into endogenous cox-4 locus to create a C-terminal translational GFP fusion. Outer membranes are stably labeled with the TOMM-20::Halotag transgene, and the mitochondria matrix are labeled with COX-4::GFP. Reference: Fan X, et al. G3 (accepted).
EL610 C. elegans smrc-1(om143[3xflag::smrc-1]) III. Show Description
3xFlag tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL629 C. elegans cid-1(om148[cid-1::3xmyc]) pup-2(om147[3xflag::pup-2]) II. Show Description
3xMyc tag inserted at C-terminus of endogenous cid-1 locus using CRISPR/Cas9. cid-1 also known as pup-1. 3xFlag tag inserted at N-terminus of endogenous pup-2 locus using CRISPR/Cas9. Reference: Li Y, et al. Development. 2018 Oct 10;145(19):dev165944. doi: 10.1242/dev.165944. PMID: 30305273.
EL634 C. elegans met-2(om142 [3xflag::met-2]) III. Show Description
3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. Reference: Mutlu B, et al. Sci Adv. 2018 Aug 22;4(8):eaat6224. doi: 10.1126/sciadv.aat6224. PMID: 30140741.
EL658 C. elegans smrc-1(om138) met-2(om142[3xflag::met-2])/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP smrc-1(om138) met-2(om142) homozygotes (reduced fertility, reduced embryonic viability and high incidence of male offspring). Defects are more prominent in M-Z- animals at 25C. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL662 C. elegans pup-3(om150[3xflag::pup-3]) I. Show Description
3xFlag tag inserted at N-terminus of endogenous pup-3 locus using CRISPR/Cas9. Reference: Li Y, et al. Development. 2018 Oct 10;145(19):dev165944. doi: 10.1242/dev.165944. PMID: 30305273.
EL663 C. elegans smrc-1(om144[3xmyc::smrc-1]) met-2(om142[3xflag::met-2]) III. Show Description
3xmyc tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL716 C. elegans pup-4(om151[pup-4::3xflag]) II. Show Description
3xFlag tag inserted at C-terminus of endogenous pup-4/F43E2.1 locus using CRISPR/Cas9. Reference: Kelley L, et al. Development. 2024 Oct 7;228(2):iyae120. doi: 10.1093/genetics/iyae120. PMID: 39067069.
ERT529 C. elegans unc-119(ed3) III; jySi40. Show Description
jySi40 [vha-6p::NANOLUC::3xFLAG::unc-54 3' UTR + Cbr-unc-119(+)]. Can be used as a Nanoluciferase (NanoLuc) expressing control for luminescence in Promega NanoGlow Assays. Reference: Sfarcic I, et al. Genetics. 2019 Dec;213(4):1197-1207. doi: 10.1534/genetics.119.302655. PMID: 31585955.
EV343 C. elegans unc-119(ed3); efEx12. Show Description
efEx12 [glp-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. GFP expression in the proliferative region of the germ line (resembling endogenous GLP-1 protein localization), and also in spermatheca and other somatic tissues. Derived by bombarding strain DP38 with LAP-tagged glp-1 fosmid (WRM0630DF02).
GLW25 C. elegans daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW33 C. elegans T28D6.6(utx25[T28D6.6::mNG::3xFlag]) III. Show Description
Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW35 C. elegans gldi-2(utx27[mNG::3xFlag::T13C2.6]) II. Show Description
T13C2.6. N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at gldi-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34.
GLW39 C. elegans ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. Show Description
N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38.
GLW41 C. elegans nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. Show Description
N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40.
GLW43 C. elegans edc-3(utx35[mNG::3xFlag::edc-3]) I. Show Description
N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.
GLW45 C. elegans ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III Show Description
C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.
GLW47 C. elegans hsp-4(utx39[hsp-4::mNG::3xFlag]) II. Show Description
C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.
GLW51 C. elegans cey-1(utx43[mNG::3xFlag::cey-1]) II. Show Description
N-terminal tag of CEY-1 via CRISPR/Cas9 knock-in of mNeonGreen at cey-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' accagaggaagaacagaagcgcgcggaaca 3'; Right flank: 5' ATGGCGGAGAAAAACgtaagtgtgtgtctc 3' (1 silent mutation); sgRNA: acacacacttacGTTTTTCT; Cas9/sgRNA plasmid: pGLOW71; mNG^SEC^3xFlag plasmid: pGLOW93; SEC insertion allele strain (balanced): GLW50.
GLW57 C. elegans asp-3(utx47[mNG::3xFlag::asp-3]) X. Show Description
N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58.
GLW63 C. elegans pqn-59(utx51[mNG::3xFlag::pqn-59]) I. Show Description
N-terminal tag of PQN-59 via CRISPR/Cas9 knock-in of mNeonGreen at pqn-59 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gaccctttttatttataatttgttttcaga 3'; Right flank: 5' ATGGGTATTAAAGGCGACAAAAAAGCTACT 3’ (1 silent mutation); sgRNA: TGCAAGTCGCGCTTGATCGC; Cas9/sgRNA plasmid: pGLOW23; mNG^SEC^3xFlag plasmid: pGLOW24; SEC insertion allele strain (balanced): GLW62.
GLW73 C. elegans H34C03.2(utx55[mNG::3xFlag::H34C03.2]) IV. Show Description
N-terminal tag of H34C03.2 via CRISPR/Cas9 knock-in of mNeonGreen at H34C03.2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gggattgcctacactcaaatatacgtaacg 3'; Right flank: 5' ATGCCCACGCCGGAAGTGTTCCCATGGATG 3’ (4 silent mutations); gRNA: cgtaacgATGCCAACTCCCG; Cas9/sgRNA plasmid: pGLOW9; mNG^SEC^3xFlag plasmid: pGLOW106; SEC insertion allele strain: GLW72.
GLW77 C. elegans jnk-1(utx59[mNG::3xFlag::jnk-1]) IV. Show Description
N-terminal tag of JNK-1 via CRISPR/Cas9 knock-in of mNeonGreen at jnk-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' cagcaagttaaagtgtgtgatcctgtgcac 3'; Right flank: 5' ATGGAGGAACGATTATCCACAACATCATCG 3’; gRNA: gtgtgatcctgtgcacATGG; Cas9/sgRNA plasmid: pGLOW114a; mNG^SEC^3xFlag plasmid: pGLOW116; SEC insertion allele strain: GLW76.
GLW95 C. elegans F13E6.1(utx75[F13E6.1::mNG::3xFlag]) X. Show Description
C-terminal tag of F13E6.1 via CRISPR/Cas9 knock-in of mNeonGreen at F13E6.1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AAATCGTGCTCTCCCAAGCA 3’; rev – 5’ CTTGTCACCTGACGGGATGT 3’. Left flank: 5' CCAGTTGCGGAGGAGGCGAAGCCAATCTCT 3' (1 silent mutation); Right flank: 5' TAAattcattcatttcacataccaatatgt 3'; sgRNA: atgaatTTAAGAGATTGGCT; Cas9/sgRNA plasmid: pGLOW26; mNG^SEC^3xFlag plasmid: pGLOW104; SEC insertion allele strain: GLW94.
GOU2162 C. elegans che-3(cas443[gfp::che-3]) I; xbx-1(cas502[xbx-1::tagRFP]) V. Show Description
Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous che-3 locus at the N-terminus and tagRFP::3xFlag inserted into the endogenous xbx-1 locus at the C-terminus by Cas9-triggered homologous recombination. Fluorescence enriched in most if not all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
GOU2187 C. elegans klp-20(cas447[klp-20::gfp]) III; xbx-1(cas502[xbx-1::tagRFP]) V; ift-81(cas498[ift-81::tagBFP]) X. Show Description
Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous klp-20 gene at its C-terminus, tagRFP::3xFlag inserted into the endogenous xbx-1 gene at its C-terminus and tagBFP inserted into the endogenous ift-81 gene at its C-terminus by Cas9-triggered homologous recombination. GFP enriched at the proximal region (middle segment) of amphid or phasmid sensory cilia while red and blue fluorescence enriched along the whole cilia. Very weak fluorescence in the cell bodies of ciliated neurons.
GW1262 C. elegans xeSi302 II; gwIs114. Show Description
xeSi302 [nhx-2p::npp-9::GFP::BLRP::3xFLAG::unc-54 3'UTR + Cbr-unc-119(+)] II. gwIs114 [hsp-16.2p::hlh-1 + rol6(su1006)]. Intestine-specific expression of nuclear GFP reporter. Rollers have heat-shock-inducible expression of hlh-1 transcription factor. gwIs114 was generated using constructs provided by Michael W. Krause`s lab (NIDDK). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
GW1539 C. elegans gwSi34 II; met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
gwSi34 [lem-2p::lem-2::GFP-3xFlag::lem-2 3'UTR] II. Superficially wild-type. Endogenously tagged met-2 locus. LEM-2::GFP is detectable at the nuclear periphery, and MET-2::mCherry signal detectable throughout nucleoplasm of all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1623 C. elegans arle-14(gw1623[GFP::TEV::3xFLAG::arle-14]) met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 and arle-14 loci. MET-2::mCherry and GFP::ARLE-14 signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
HW1822 C. elegans lin-29(xe61[lin-29::gfp::3xflag]) II Show Description
Low penetrance Pvl (i.e., tagged protein appears not fully functional). CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to LIN-29. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., Mol Cell. 2017 Feb 2;65(3):476-489.
HW1826 C. elegans lin-29(xe63[gfp::3xflag::lin-29a]) II. Show Description
Superficially wild-type. CRISPR/Cas9-engineered allele adds GFP and 3xflag tag to the N-terminus of LIN-29A. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Aeschimann F, et al., (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. http://dx.doi.org/10.26508/lsa.201900335 )
HW1835 C. elegans lin-29(xe40 xe65[lin-29b::gfp::3xflag]) II. Show Description
Partially penetrant Pvl and Egl. xe40 specifically disrupts the LIN-29A isoform. The GFP tag was inserted at the shared C-terminus of LIN-29A/B in the xe40 background, so only the labeled B isoform is expressed. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Pereira et al., (2019) Timing mechanism of sexually dimorphic nervous system differentiation. eLIFE 8: e42078. https://doi.org/10.7554/eLife.42078
IG2212 C. elegans spia-1(fr201[spia-1::mNG(internal)::3xFLAG] X. Show Description
Internal mNeonGreen::3xFLAG tags inserted into endogenous spia-1 locus.
JCP341 C.elegans jcpSi10 II; unc-119(ed3) III. Show Description
jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP378 C. elegans jcpSi19 II; unc-119(ed3) III. Show Description
jcpSi19 [eft-3p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP383 C. elegans jcpSi10 II; ints-6(tm1615) IV. Show Description
jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP387 C. elegans jcpSi24 II; unc-119(ed3) III. Show Description
jcpSi24 [H27M09.5p::H27M09.5::3xFLAG::eGFP::H27M09.5 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP394 C. elegans jcpSi31 II; unc-119(ed3) III. Show Description
jcpSi31 [Y75B8A.23p::Y75B8A.23::3xFLAG::eGFP::Y75B8A.2 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.
JCP405 C. elegans jcpSi37 II; unc-119(ed3) III. Show Description
jcpSi37 [F08H9.3p::F08H9.3::3xFLAG::eGFP::F08H9.3 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.