Strain Information
| Name | GLW25 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | daf-18(utx19[mNG::3xFlag::daf-18]) IV. |
| Description | Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021. |
| Mutagen | CRISPR/Cas9 homologous recombination |
| Outcrossed | x0 |
| Made by | Amaka Okafor (Glow Worms '20) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.