More Fields
Strain Species Genotype
AD294 C. elegans cylc-2(mon2[cylc-2::mNG::3xFLAG) I; him-5(e1490) V. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
AGK192 C. elegans unc-119(ed3) III; zdIs13 IV; armIs5. Show Description
zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.
AGK280 C. elegans zfp-1(ok554) unc-119(ed3) III; armEx14. Show Description
armEx14 [PHD1-PHD2::FLAG + zfp-1(short isoform) + unc-119(+)]. Pick non-Unc animals to maintain. The fosmid-based armEx14 transgene rescues zfp-1(ok554)/nDf17 lethality. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK369 C. elegans zfp-1(ok554) III; armIs8. Show Description
armIs8 [zfp-1(short isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs8 transgene rescues the protruded vulva phenotype of zfp-1(ok554). Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK370 C. elegans zfp-1(ok554) III; armIs9. Show Description
armIs9 [zfp-1(long isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs9 transgene rescues zfp-1(ok554)/nDf17 lethality. Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AH5059 C. elegans let-23(zh131[FRT::let-23::FRT::GFP::LoxP::FLAG::let-23]) II. Show Description
CRISPR allele of endogenous let-23, which expresses let-23::GFP fusion protein and is susceptible for conditional knock-out via incorporated FRT sites with FLPase expression. Reference: Konietzka et al. 2019. Current Biology (accepted).
AMP100 C. elegans ieSi57 II; rpb-2(cer135[rpb-2::GFP(delta)piRNA::AID::3xFLAG]) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. cer135 is a rpb-2::GFP(delta)piRNA::AID::3xFLAG tag inserted into the endogenous rpb-2 locus. This strain allows auxin-dependent disruption of RNA polymerase II with dose-dependent lifespan shortening. Reference: Oswal N, et al. PLoS Comput Biol. 2022 Sep 30;18(9):e1010415. PMID: 36178967.
APL31 C. elegans lin-12(ljf31[lin-12::mNeonGreen[C1]::3xFLAG]) III. Show Description
mNG and 3xFLAG tags fused to the C-terminal end of the intracellular domain of the endogenous lin-12 locus using a 9 amino acid flexible linker. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
BB259 C. elegans adr-1(uu49) I; adr-2(uu28) III; ggIs1 IV. Show Description
ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
BB278 C. elegans adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) III; ggIs1 IV. Show Description
ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
BN646 C. elegans bqSi640 II; bqSi470 IV. Show Description
bqSi640 [dpy-7p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi470 [hsp-16.41p::FLAG::NLS::FLP D5 + unc-119(+)] IV. Expression of red and green histones in hypodermal lineage before and after heat shock, respectively.
BR7827 C.elegans endu-2(tm4977) X; byEx1551. Show Description
byEx1551 [vha-6p::endu-2::eGFP::3xFLAG + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene provides intestinal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.
BR8551 C.elegans endu-2(tm4977) X; byEx1795. Show Description
byEx1795 [unc-119p::endu-2::eGFP::3xFlag + rol-6(su1006)]. Pick Rollers to maintain. Transgene provides neuronal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.
CA1369 C. elegans zhp-1(ie62[zhp-1::AID::3xFLAG]) I; meIs8 II; spo-11(ie59[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
CA1377 C. elegans zhp-2(ie67[zhp-2::AID::3xFLAG]) I; meIs8 II; spo-11(ie60[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
CA1421 C. elegans meIs8 dsb-2(ie58[dsb-2::AID::3xFLAG]) II; ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
CA1423 C. elegans meIs8 II; spo-11(ie59[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
CU7905 C. elegans smIs350 IV; unc-76(e911) V. Show Description
smIs350 [hsp-16::mCherry-NLS + tra-2::FLAG(3x) + unc-76(+)] IV. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.
CZ25013 C. elegans unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. Show Description
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
CZ26494 C. elegans juSi364 IV; acr-2(n2420) X. Show Description
juSi364 [unc-17Bp::3xFLAG::eif-3.g::SL2::GFP] IV. GFP expression in cholinergic motor neurons. Convulsing worms. Strain is suitable for neuron-type eCLIP. Reference: Blazie S, et al. Elife. 2021 Jul 29;10:e68336. PMID: 34323215.
CZ27593 C. elegans bli-1(ju1789[bli-1::mNG::3xFLAG]) II. Show Description
Superficially wild type with green fluorescence in L4 epidermis and adult stage cuticle. mNeonGreen and 3xFLAG tags inserted in N-terminus of endogenous BLI-1 locus at A106 (after subtilisin cleavage site) using Dickinson method. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
CZ27748 C. elegans vwa-8(ju1799[vwa-8::GFP::3xFLAG]) X. Show Description
Endogenous vwa-8 locus tagged with GFP and 3xFLAG. VWA-8::GFP is expressed in mitochondria of hypodermis, intestine, and muscle, but not detectable in neurons. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263.
CZ29114 C. elegans bli-6(ju1914[bli-6::mNG::3xFLAG]) IV. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-6 locus using Dickinson method. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
DA2356 C. elegans ced-1(e1735) I; ced-3(n717) IV; lin-15B&lin-15A(n765) X; adEx2342. Show Description
adEx2342 [efl-3::mCherry::FLAG + LIN-15(+)]. Maintain by picking non-Muv. Fluorescence is dim, but array is stable (>95% transmission).
DE115 C. elegans dnSi8 I; unc-119(ed3) III; dnIs22. Show Description
dnSi8 [tdp1::flag::mCherry + Cbr-unc119(+)] inserted into ttTi5605 on LG II. Nuclear-localized mCherry. dnIs22 [sup-46::GFP + unc-119(+)] (site of integration unknown). Strong nuclear-localized GFP expression. [NOTE: This strain was produced by crossing two parental strains carrying strong unc-119 loss of function alleles. One parent was carrying ed3; the allele in the other parental strain is unknown.]
DE130 C. elegans unc-119(e2488) III; dnIs24. Show Description
dnIs24 [sup46::flag::mCherry + Cbr-unc-119(+)]; site of integration unknown. Strong nuclear-localized mCherry.
DG4158 C. elegans spn-4(tn1699[spn-4::gfp::3xflag]) V. Show Description
Apparently wild type
DG4190 C. elegans cdc-25.3(tn1712[gfp::3xflag::cdc-25.3]) III. Show Description
Superficially wild type
DG4213 C. elegans meg-1(tn1724[gfp::3xflag::meg-1]) X. Show Description
Superficially wild type
DG4215 C. elegans puf-5(tn1726[gfp::3xflag::puf-5]) II. Show Description
Superficially wild type
DG4218 C. elegans cpg-1(tn1728[mNG::3xflag::cpg-1]) III. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous cpg-1 locus. Superficially wild type.
DG4222 C. elegans pos-1(tn1730[gfp::3xflag::pos-1]) V. Show Description
Superficially wild type
DG4228 C. elegans orc-1(tn1732[mNeonGreen::3xflag::orc-1]) III. Show Description
Superficially wild type
DG4230 C. elegans gla-3a(tn1734[gfp::3xflag::gla-3a]) I. Show Description
Superficially wild type
DG4233 C. elegans pqn-59(tn1737[gfp::3xflag::pqn-59]) I. Show Description
Superficially wild type
DG4269 C. elegans mex-3(tn1753[gfp::3xflag::mex-3]) I. Show Description
Superficially wild type
DG4324 C. elegans pod-2(tn1765[gfp::3xflag::pod-2]) II. Show Description
Homozygous viable, gfp expression in intestine, hypodermis, somatic gonad, excretory duct, CAN neuron. Reference: Starich et al. eLife 2020;9:e58619. DOI: https://doi.org/10.7554/eLife.58619
DG4392 C. elegans cyb-3(tn1755[gfp::3xflag::cyb-3]) V. Show Description
Although this strain is maintainable as a homozygote it produces many dead embryos (~80%) and has a low viable brood size (~24 ± 18). Thus, the GFP tag compromises CYB-3 function.
DG4569 C. elegans cyb-1(tn1806[cyb-1::gfp::tev::3xflag]) IV. Show Description
Viable and fertile, grows and moves well. No apparent abnormalities yet noted. Reference: Spike CA, et al. Genetics. 2022 May 5;221(1):iyac051. doi: 10.1093/genetics/iyac051. PMID: 35377419
DQM1051 C. elegans lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1066 C. elegans cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1068 C. elegans cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1070 C. elegans cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
DQM1072 C. elegans cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
DQM1152 C. elegans bmdSi243 I; ljf3(unc-34::mNG[C1]^3xFlag::AID) V; qy41(lam-2::mKate2) X. Show Description
bmdSi243 (LoxN + cdh-3p::TIR1::F2A::DHB::2xmTurquoise2) I. bmdSi243 is a MosSCI insertion. mNG tag inserted into the C-temrinus of the endogenous unc-34 locus. mKate2 tag inserted into the C-temrinus of the endogenous lam-2 locus.
DQM455 C. elegans cki-1(bmd132[GFP::LoxP::cki-1::3xFLAG]) II. Show Description
CRISPR/Cas9 insertion of GFP into the N-terminus of cki-1; seems to cause cki-1 gain-of-function phenotype (early cell cycle exit for some post-embryonic blast cells). Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888
DQM984 C. elegans bmdSi245 pbrm-1(st12226[pbrm-1::TY1::EGFP::3xFLAG]) I. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DV3089 C. elegans rheb-1(re64[mKate2::3xFlag::rheb-1]) III. Show Description
mKate tag inserted at 5' end of endogenous rheb-1 locus. Ubiquitous expression.
DV3285 C. elegans his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
DV3312 C. elegans rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. Show Description
Ubiquitous expression with cytosolic localization. Derived in an N2 background. Detection with triplex primers: HS125 5’-CTTGTCACTGTAAGGGAAGATTTCC-3’ HS126 5’-TTGTCCTCCTCTCCCTTGG-3’ HS127 5’ ACGTAGAATGTTCCAGAGTTCCAG-3' Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501