Strain Information
| Name | GLW39 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. |
| Description | N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38. |
| Mutagen | CRISPR/Cas9 homologous recombination |
| Outcrossed | x0 |
| Made by | Anita Rhodes (Glow Worms '20) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.