Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
BR2823 C. elegans chn-1(by155) I. Show Description
989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.
CB5495 C. elegans bus-10 & ZK596.4 & ZK596.5(e2715) IV. Show Description
Viable, Bus, resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2715 is a small deficiency (3191 bp) which removes all of the bus-10 exons and internal ncRNA genes ZK596.4 & ZK596.5. Reference: O'Rourke et al (in preparation).
CB6921 C. elegans bus-10 & ZK596.4 & ZK596.5 & ZK596.1(e2737) IV. Show Description
Viable, Bus (M. nematophilum resistant), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. e2737 is a ~4.5 kb deficiency which removes all of the bus-10 exons, internal ncRNA genes ZK596.4 & ZK596.5, and ZK596.1. Reference: O'Rourke et al (in preparation).
CB6931 C. elegans bus-10 & ZK596.4 & ZK596.5(e2715) IV; dhs-29(e3014) X. Show Description
Bus, bleach-sensitive, resistant to Leucobacter Verde2 and Leucobacter Verde1. e2715 is a small deficiency (3191 bp) which removes all of the bus-10 exons and internal ncRNA genes ZK596.4 & ZK596.5. Reference: O'Rourke et al (in preparation).
DCR9280 C. elegans unc-47(syb7313[unc-47::GFP11]) III. Show Description
Split GFP11 tag inserted in endogenous unc-47 locus (internal tag). Requires co-expression of complementary GFP1-10. See https://elifesciences.org/reviewed-preprints/108675 for sequencing information. Reference: Cuentas-Condori A, et al. bioRxiv 2025.08.18.670838; doi: https://doi.org/10.1101/2025.08.18.670838
DCR9453 C. elegans unc-47(syb7358[unc-47::mKate2]) III. Show Description
mKate2 tag inserted in endogenous unc-47 locus (internal tag). Full-body expression of UNC-47::mKate2. Part of SynaptoTagMe toolkit for examining cell-specific GABAergic transmission. See https://elifesciences.org/reviewed-preprints/108675 for sequencing information. Reference: Cuentas-Condori A, et al. bioRxiv 2025.08.18.670838; doi: https://doi.org/10.1101/2025.08.18.670838
DCR9739 C. elegans unc-47(syb7849[unc-47::3xGFP11]) III. Show Description
Three copies of split GFP11 tag inserted in endogenous unc-47 locus (internal tag). Requires co-expression of complementary GFP1-10. See https://elifesciences.org/reviewed-preprints/108675 for sequencing information. Reference: Cuentas-Condori A, et al. bioRxiv 2025.08.18.670838; doi: https://doi.org/10.1101/2025.08.18.670838
DG1770 C. elegans cgh-1(ok492) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C07H6.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok492 homozygotes (sterile adult, tends to explode at vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCAGCTCGAAAATATTGCC. External right primer: GGAAAACCGCAAGGATGGTGG. Internal left primer: TCACGGAGCTAGATGTGACG. Internal right primer: CGTCAAAAAGAACCCGATGT. Internal WT amplicon: 3095 bp. Deletion size: 1043 bp. Deletion left flank: GAGAACATACACAATCTGGACGAGATCACT. Deletion right flank: CCTGGGGTGGCGATGACCAAGTGAACCGTT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
EG10245 C. elegans unc-119(ox819) III; cha-1(ox1298[cha-1::attB]) IV. Show Description
Internal PhiC31 attB site inserted into the endogenous cha-1 coding sequence. Unc; can be rescued by expression of the C. briggsae unc-119 gene (Cbr-unc-119). Reference: Hefel A, et al. bioRxiv. 2026 Jan 15:2026.01.15.699741. doi: 10.64898/2026.01.15.699741. PMID: 41648400.
EL476 C. elegans rrf-2(ok210) I. Show Description
M01G12.12. External left primer: GAGTGGTGGGCAATTGAGTT. External right primer: CCACCCAAGATCTGGTCAGT. Internal left primer: TGTCAACTTGAGGATCGACG. Internal right primer: ATTCCTGCAATTGGTCAAGG. Internal WT amplicon: 2509 bp. Deletion size: 979 bp. Deletion left flank: ATTTTCAACGAAAGTTTTTCGGTTATTTCA. Deletion right flank: AGAGGAAAAAATACGGACAAGAAGAATAAT.
EL694 C. elegans pup-4(om140) II. Show Description
pup-4/F43E2.1. Maintain at 15-20C. Homozygotes produce <1% sterile individuals at 25C after multiple generations. ~10% of fertile individuals contain one infertile gonad arm. om140 is a CRISPR-engineered internal deletion removing most of the pup-4 coding sequence. Reference: Kelley L, et al. Development. 2024 Oct 7;228(2):iyae120. doi: 10.1093/genetics/iyae120. PMID: 39067069.
ET100 C. elegans H01G02.2(ok200) IV. Show Description
H01G02.2. External left primer: TGCATCCCTTTGATTCCTTC. External right primer: AAACCTGGGCGCTTTTATTT. Internal left primer: GCAATCCTTGCTTGATCCAT. Internal right primer: TGATTGCAACGTTCCATGAT. Internal WT amplicon: 3033 bp. Deletion size: 1251 bp. Deletion left flank: AAACTCACTTTTGAAACATTCGGGACCATT. Deletion right flank: GATGAAGATCATGGAACGTTGCAATCAATT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
GLW53 C. elegans egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV. Show Description
Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.
HW1329 C. elegans lin-41(xe11) I. Show Description
Egg-laying (Egl) defects and subsequent internal hatching of progeny (Bagging) in > 95% of animals. xe11 is a C-to-U point mutation in each of the endogenous let-7 complementary sites, LCS1 and LCS2 [I:C9,335,211T & I:C9,335,260T]. xe11 is a weak gain-of-function allele: mutation of two functionally relevant let-7 binding sites impairs repression by let-7 causing over-expression of LIN-41 in L4 stage animals. Reference: Ecsedi M, et al. Dev Cell. 2015 Feb 9;32(3):335-44. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
IG2212 C. elegans spia-1(fr201[spia-1::mNG(internal)::3xFLAG] X. Show Description
Internal mNeonGreen::3xFLAG tags inserted into endogenous spia-1 locus.
JDW1007 C. elegans wrdSi142 II; nas-31(wrd438[nas-31::7xGFP11::3xFLAG]) V. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd438 is an internal (2nd last exon; 63 amino acids from C-terminus) modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous nas-31 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5548: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1.
JDW1043 C. elegans nas-36(wrd452[nas-36::7xGFP11::3xFLAG]) I; wrdSi142 II. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd452 is an internal (36 aa from C-term) modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous nas-36 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5548: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1.
JDW389 C. elegans bli-1(wrd84[bli-1::linker::mNeonGreen::3xFLAG(internal)::linker]) II. Show Description
Internal mNeonGreen::3xFLAG tags with linker sequences inserted into endogenous bli-1 locus. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.
JDW460 C. elegans noah-1(wrd119[noah-1::linker::mNeonGreen(dpiRNA)::3xFLAG(internal)::linker]) I. Show Description
Internal mNeonGreen(dpiRNA)::3xFLAG tags with linker sequences inserted into endogenous noah-1 locus. mNeonGreen(dpiRNA) is optimized to remove all piRNA sites. Superficially wild-type. Reference: Johnson LC, et al. Development 2023; dev.201085. doi: https://doi.org/10.1242/dev.201085.
JDW829 C. elegans col-10(wrd345[col-10::linker::mNG::3xFLAG::linker (internal)]) V Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 2 of the endogenous col-10 locus by CRISPR which will produce a translational fusion after amino acid 89. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW834 C. elegans unc-119(kst33) col-97(wrd346[col-97::internal mNG::3xFLAG + unc-119(+)]) III. Show Description
Superficially wild type. Modular linker::mNeonGreen::3xFLAG::linker tag inserted in the endogenous col-97 locus by CRISPR to produce a translational fusion inserted internally near the C-terminus (after amino acid 288). Allele obtained using plasmid-based unc-119 selection. Injection of a Cre recombinase plasmid failed to excise the loxP-flanked unc-119(+) cassette for unknown reasons. The insert was verified to be correct through Sanger sequencing. Knock-in is linked to the temperature-sensitive unc-119(kst33) allele. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW877 C. elegans wrt-2(wrd365[linker::mNG::3xFLAG::linker (internal)]) X. Show Description
Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 1 in the endogenous wrt-2 locus by CRISPR; produces a translation fusion after amino acid 18, immediately following the signal peptide.. Allele obtained using plasmid-based unc-119 selection in a temperature-sensitive unc-119(kst33) III background The unc-119(+) cassette was removed through Cre-mediated excision and the unc-119(kst33) allele was removed by outcrossing. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.
JDW894 C. elegans cpz-1(wrd128 wrd379[cpz-1::internal mScarlet::2xOLLAS]) I. Show Description
Superficially wild type. Linker::mScarlet::2xOLLAS::linker inserted internally, to produce a translational fusion 11 amino away from the C-terminus of the endogenous cpz-1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd128.
JDW907 C. elegans wrdSi133 bli-1(wrd381[bli-1::7xGFP11::3xFLAG]) II. Show Description
Internal (exon 2; after amino acid 106) modular linker::7xGFP11::3xFLAG::linker tag inserted internatlly into the endogenous bli-1 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi133 [loxP myo-2p::NLS::mNeonGreen + rps-0p HygR + loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. Derived by sequential edits of parental strain NM5548: wrdSi133 was an insertion into jsSi1726.
JDW987 C. elegans wrdSi142 II; col-34(wrd421[col-34::7xGFP11::3xFLAG]) IV. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10::ubl-1 3'UTR FRT3] II. wrd421 is an internal (last exon; 11 amino acids from C-terminus) modular linker::7xGFP11::3xFLAG::linker tag inserted into the endogenous col-34 locus by CRISPR/Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. wrdSi142 was derived by sequential edits of parental strain NM5548: wrdSi133 was an insertion into jsSi1726, and subsequent excision left [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site. ssGFP1-10 contains an N-terminal signal sequence from OIG-1.
JK3172 C. elegans mig-5&cct-1(ok280)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T05C12.6, T05C12.7. Heterozygotes are WT and GFP+ in the pharynx. mIn1[mIs14 dpy-10(e128)] homozygotes are Dpy and GFP+ in the pharynx. Homozygous mig-5&cct-1(ok280) worms arrest at about L2/L3. Strong loss of function for cct-1 and weak for mig-5. mig-5 is a dishelved homologue. External left primer: CGGCCTAAACGTTGATTGTT. External right primer: CAGAGTGAGTCGTGAACCGA. Internal left primer: TAATCCTGAATCCGGACGAG. Internal right primer: TACGAGATTTCGGTCCCTTG. Internal WT amplicon: 3284 bp. Deletion size: 987 bp. Deletion left flank: GCTGCAGTCTGATGTGCATGGCGGCTCCAT. Deletion right flank: TTGGTGTTGTCTATGCTTCAAGAAAATTGA. Do not distribute this strain; other labs should request it from the CGC.
JK3203 C. elegans puf-7(ok397) IV. Show Description
B0273.2. External left primer: AAGCATACAGGCGCAGAGAT. External right primer: TACCGTATTGTGGTGCGAAA. Internal left primer: AACGGTTGCTCATCTGACTT. Internal right primer: AAAATTGCGTCGATTTTTGG. Internal WT amplicon: 2701 bp. Deletion size: 1751 bp. Deletion left flank: TTAAAACTTCTAATTTAAATAAAAAATATA. Deletion right flank: TATGTCGTTCAGCAAATGATTTCGATTTGC. Do not distribute this strain; other labs should request it from the CGC.
JK5731 C. elegans cya-1(q903[cya-1::3xMyc]) III. Show Description
Internal 3xMyc tag inserted into endogenous cya-1 locus.
JK5742 C. elegans cyb-3(q914[cyb-3::3xMyc]) V. Show Description
Internal 3xMyc tag inserted into endogenous cyb-3 locus.
JK5745 C. elegans cyd-1(q917[cyd-1::3xMyc]) II. Show Description
Internal 3xMyc tag inserted into endogenous cyd-1 locus.
JK6140 C. elegans nos-3(q902) II; qSi380 IV. Show Description
qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
JK6268 C. elegans qSi380 IV. Show Description
qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3’utr::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem–loops in its 3′UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The gfp reporter RNA has three functional boxB stem–loops in its 3′UTR; the mCherry reporter 3′UTR has three mutated boxB stem–loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
JT307 C. elegans egl-9(sa307) V. Show Description
243 bp internal deletion.
KRA867 C. elegans tol-1(syb8406[3xLinker::WrmScarlet::linker::3xFLAG]) I; lat-1(syb8408[lat-1(before 651 aa)aaaaA::EGFP::linker::3xFLAG::aaaaA]) II. Show Description
syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
LC35 C. elegans cat-4(ok342) V. Show Description
T21C9.2, F32G8.6. Serotonin-deficient by anti-serotonin staining. Bleach hypersensitive. Likely also dopamine-deficient (but not tested). Slightly sickly. External left primer: TTTCTTTTCTTGTTGCGCCT. External right primer: TCGAAAAAGTCTGCTTCGGT. Internal left primer: CGTCTTCCGTTTCTTTTTCG. Internal right primer: TCTTGGAATGTGGGATGTGA. Internal WT amplicon: 2497 bp. Deletion size: 2238 bp. Deletion left flank: CGACTAGATTGATTTCCTTCTGTCCCTTCA. Deletion right flank: CTTGACGGAACAACGCCTCGATCTGATCTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
LP705 C elegans dsh-1(cp375[dsh-1::mNG-C1::3xFlag]) II. Show Description
Internal mNG::3xFlag tags inserted into endogenous dsh-1 locus between DIX and PDZ-DEP domains using Cas9-triggered homologous recombination. dReference: Heppert JK, et al. 2017 Genetics. In press.
MD5004 C. elegans drp-1(dx230[drp-1::mNeonGreen]) IV. Show Description
mNeonGreen tag inserted into the variable region of endogenous drp-1 locus (internal tag). N- and C-terminal fusions of DRP-1 cause a block in mitochondrial fission (acting as dominant-negatives), whereas internally-tagged DRP-1 protein has close to wild-type activity. Generated in N2 background. Reference: Lambie EJ & Conradt B. MicroPubl Biol. 2025 May 8;2025:10.17912/micropub.biology.001588. PMID: 40415901.
NK2585 C. elegans emb-9(qy83[emb-9::mRuby2 + LoxP]) III. Show Description
mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2651 C. elegans lin-35(n745) I; emb-9(qy83[emb-9::mRuby2 + LoxP]) III. Show Description
CRISPR/Cas9 insertion of mRuby2G into the endogenous emb-9 locus (internal tag) in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2688 C. elegans fbn-1(qy107[fbn-1::mNG (internal tag) + LoxP]) III. Show Description
mNG tag inserted into the endogenous fbn-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2698 C. elegans sax-3(qy113[sax-3::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous sax-3 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2700 C. elegans eva-1(qy114[eva-1::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous eva-1 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2705 C. elegans col-99(qy118[col-99::mNG (internal tag) + LoxP]) IV. Show Description
mNG tag inserted into the endogenous col-99 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2751 C. elegans T19D12.6(qy149[T19D12.6::mNG + LoxP]) II. Show Description
mNG tag inserted into the endogenous T19D12.6 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2764 C. elegans adm-4(qy153[adm-4::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous adm-4 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2765 C. elegans qySi120[eef-1A.1p::iATPSnFR1.0::unc-54 3'UTR] I. Show Description
Superfically wild-type strain with ubiquitous somatic expression of ATP biosensor iATPSnFR1.0 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal iATPSnFR1.0 reverse primer: 5' CTTCATCTCGGCGACGGAGAGACGGTT 3'
NK2920 C. elegans emb-9(qy83[emb-9::mRuby2 + LoxP]) III; gon-1(qy45[gon-1::mNG+LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus and mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK3189 C. elegans qySi275 I. Show Description
qySi275 [nduv-2p::mNG::P2A::mKate2::unc-54 3'UTR] I. nduv-2 transcriptional reporter fused to mNeonGreen and mKate2. Inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.
NK3325 C. elegans qySi316 I. Show Description
qySi316 [nuo-1p::mNG::P2A::mKate2::unc-54 3'UTR] I. Transcriptional nuo-1 reporter fused to mNeonGreen and mKate2 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination. Internal mKate2 reverse primer: 5' CCTTGATTCTCATGGTCTGAG 3'. Superfically wild-type.
PHX6990 C. elegans unc-47(syb6990[unc-47::GFP]) III. Show Description
GFP tag inserted in endogenous unc-47 locus (internal tag). Full-body expression of UNC-47::GFP. Part of SynaptoTagMe toolkit for examining cell-specific GABAergic transmission. See https://elifesciences.org/reviewed-preprints/108675 for sequencing information. Reference: Cuentas-Condori A, et al. bioRxiv 2025.08.18.670838; doi: https://doi.org/10.1101/2025.08.18.670838