Strain Information

Name GLW35   View On Wormbase
Species C. elegans
GenotypeT13C2.6(utx27[mNG::3xFlag::T13C2.6]) II.
DescriptionN-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at T13C2.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34.
MutagenCRISPR/Cas9 homologous recombination
Outcrossedx0
Made byStaci Guillen (Glow Worms '21)
Laboratory GLW
Reference N/A
Sign in or register an account if you want to order this strain.