More Fields
Strain Species Genotype
CYA1 C. elegans rexIs1. Show Description
rexIs1 [hsp-16p::halo::TEV::Keap1 + mec-7p::mRFP]. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of Halo protein with TEV recognition site for the tobacco etch virus protease and human Keap1 protein (an established RES sensor). No phenotypic change upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.
DG3913 C. elegans strain/search?st1=lin-41&sf1=all">lin-41(strain/search?st1=tn1541&sf1=all">tn1541[strain/search?st1=GFP&sf1=all">GFP::strain/search?st1=tev&sf1=all">tev::s::strain/search?st1=lin-41&sf1=all">lin-41]) I. Show Description
lin-41(tn1541[GFP::tev::s::lin-41]) I. May be maintained under normal conditions.
DG3922 C. elegans strain/search?st1=tiar-1&sf1=all">tiar-1(strain/search?st1=tn1545&sf1=all">tn1545[strain/search?st1=tiar-1&sf1=all">tiar-1::s::tev::GFP]) II. Show Description
tiar-1(tn1545[tiar-1::s::tev::GFP]) II. Reference: Huelgas-Morales G., et al. G3 (Bethesda). 2016 Apr; 6(4): 1031-1047.
DZ840 C. elegans tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.
DZ841 C. elegans tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
FGP3 C. elegans unc-119(ed3) III; fgpIs23. Show Description
fgpIs23 [(pFGP78) pie-1p::GFP::TEV-S-Tag::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
FGP4 C. elegans unc-119(ed3) III; fgpIs24. Show Description
fgpIs24 [(pFGP77) pie-1p::GFP::TEV-S-Tag::smo-1(GA) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. When compared with strain FGP3, the difference in fluorescence signal corresponds to SUMO conjugation in FGP3. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
GW1419 C. elegans met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 locus, with MET-2::mCherry signal detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1539 C. elegans gwSi34 II; met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
gwSi34 [lem-2p::lem-2::GFP-3xFlag::lem-2 3'UTR] II. Superficially wild-type. Endogenously tagged met-2 locus. LEM-2::GFP is detectable at the nuclear periphery, and MET-2::mCherry signal detectable throughout nucleoplasm of all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1618 C. elegans lin-65(gw1578[lin-65::FLAG::TEV::GFP]) I. Show Description
Superficially wild-type. Endogenously tagged lin-65 locus, with LIN-65::GFP signal detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1621 C. elegans lin-65(gw1578[lin-65::FLAG::TEV::GFP]) I; met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 and lin-65 loci. MET-2::mCherry and LIN-65::GFP signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW1623 C. elegans arle-14(gw1623[GFP::TEV::3xFLAG::arle-14]) met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
Superficially wild-type. Endogenously tagged met-2 and arle-14 loci. MET-2::mCherry and GFP::ARLE-14 signal are detectable in all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
JH2549 C. elegans unc-119(ed3) III; axIs1957. Show Description
axIs1957 [pie-1p::Dendra2::TEV::S-peptide::mex-5::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2550 C. elegans unc-119(ed3) III; axIs1962. Show Description
axIs1962 [pie-1p::Dendra2::TEV::S-peptide::mex-5(S458A)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2553 C. elegans unc-119(ed3) III; axIs1958. Show Description
axIs1958 [pie-1p::Dendra2::TEV::S-peptide::mex-5(aa345-aa468)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2560 C. elegans unc-119(ed3) III; axIs1959. Show Description
axIs1959 [pie-1p::Dendra2::TEV::S-peptide::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2593 C. elegans unc-119(ed3) III; axIs1961. Show Description
axIs1961 [pie-1p::Dendra2::TEV::S-peptide::mex-5(S404A)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2607 C. elegans unc-119(ed3) III; axIs1963. Show Description
axIs1963 [pie-1p::Dendra2::TEV::S-peptide::mex-5(S404A S458A)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2636 C. elegans unc-119(ed3) III; axIs1960. Show Description
axIs1960 [pie-1p::Dendra2::TEV::S-peptide::mex-5(C286S C292S C331S C337S)::pie-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2800 C. elegans unc-119(ed3) III; axIs1964. Show Description
axIs1964 [mex-5p::GFP::TEV::FLAG::mex-5::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2801 C. elegans unc-119(ed3) III; axIs1965. Show Description
axIs1965 [mex-5p::GFP::TEV::FLAG::mex-5::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2802 C. elegans unc-119(ed3) III; axIs1950. Show Description
axIs1950 [mex-5p::Dendra2::TEV::S-peptide::mex-5RR::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2804 C. elegans unc-119(ed3) III; axIs1951. Show Description
axIs1951 [pie-1p::Dendra2::TEV::S-peptide::mex-5RR(S404A)::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2889 C. elegans unc-119(ed3) III; axIs1955. Show Description
axIs1955 [mex-5p::Dendra2::TEV::S-peptide::mex-5RR(S458A)::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2890 C. elegans unc-119(ed3) III; axIs1956. Show Description
axIs1956 [mex-5p::Dendra2::TEV::S-peptide::mex-5RR(R274E K318E)::mex-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH4008 C. elegans htp-3 (ax3010[htp-3::TEV::eGFP::myc::3Xflag]) I. Show Description
Express tagged htp-3. Reference: Paix A, et al. Genetics. 2015 Sep;201(1):47-54.
LE3845 C. elegans rdvIs1 III; egl-20(gk453010) IV; lqIs58 V. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. lqIs58 [gcy-32::CFP] V. Reference: Josephson MP, et al. PLoS One. 2016 Feb 10;11(2):e0148658.
LE3992 C. elegans rdvIs1 III; lqIs80 IV. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. lqIs80 [SCMp::GFP::caax] IV.
OD10 C. elegans unc-119(ed3) III; ltIs6. Show Description
ltIs6 [pIC35; pie-1p::kbp-5::GFP-TEV-STag + unc-119(+)].
OD11 C. elegans unc-119(ed3) III; ltIs7. Show Description
ltIs7 [(pIC41) pie-1p::kbp-4::GFP::TEV-STag + unc-119(+)].
OD13 C. elegans unc-119(ed3) III; ltIs9. Show Description
ltIs9 [pie-1p::kbp-3::GFP::TEV-S Tag + unc-119(+)].
OD142 C. elegans unc-119(ed3) III; ltIs78. Show Description
ltIs78 [(pKO5) pie-1::GFP::TEV::Stag::air-1 spliced coding + unc-119(+)].
OD27 C. elegans unc-119(ed3) III; ltIs14. Show Description
ltIs14 [(pASM05) pie-1p::GFP-TEV-STag::air-2 + unc-119(+)].
OD31 C. elegans unc-119(ed3) III; ltIs22. Show Description
ltIs22[pPM3; pie-1::GFP-TEV-STag::KNL-2 + unc-119(+)].
OD61 C. elegans unc-119(ed3) III; ltIs41. Show Description
ltIs41[pAA5; pie-1::GFP-TEV-STag::CAR-1; unc-119(+)].
OD62 C. elegans unc-119(ed3) III; ltIs42. Show Description
ltIs42[pAA19; pie-1::GFP-TEV-Stag::CAR-1deltaN; unc-119(+)].
OD63 C. elegans unc-119(ed3) III; ltIs43/+. Show Description
ltIs43[pAA26; pie-1::GFP-TEV-STag::ZEN-4; unc-119(+)]. Insertion only viable when heterozygous. Pick non-Unc worms to maintain.
OD7 C. elegans unc-119(ed3) III; ltIs3. Show Description
ltIs3[pIC31; pie-1 promoter::hcp-1::GFP-TEV-STag + unc-119(+)].
OD76 C. elegans unc-119(ed3) III; ltIs75. Show Description
ltIs75 [(pSK5) pie-1::GFP::TEV-STag::LacI + unc-119(+)].
OD8 C. elegans unc-119(ed3) III; ltIs4. Show Description
ltIs4 [(pIC32) pie-1p::mis-12::GFP::TEV-STag + unc-119(+)].
OD9 C. elegans unc-119(ed3) III; ltIs5. Show Description
ltIs5 [(pIC36) pie-1p::kbp-1::GFP::TEV-STag + unc-119(+)].
OH15815 C. elegans che-1(ot63 ot941[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot941[che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying ot63 null alllele and tagged with GFP (che-1::SEC-GFP::TEV::3xFLAG). che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.
RDV55 C. elegans rdvIs1 III. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
RDV83 C. elegans rdvIs1 III; zuIs45 V. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
RDV84 C. elegans rdvIs1 III; ddIs6 V. Show Description
rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. ddIs6 [pie-1p::GFP::tbg-1 + unc-119(+)] V. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.
VS29 C. elegans hjSi56 IV. Show Description
hjSi56 [vha-6p::3xFLAG::TEV::GFP::dgat-2::let-858 3'UTR]. Targeting construct derived from pCFJ178. Reference: Xu N, et al. J Cell Biol. 2012 Sep 3;198(5):895-911.
JU1652 C. elegans Show Description
Isolated by Rosina Giordano from compost sampled in Montevideo, Uruguay.
PX696 C. elegans fxIs10 II. Show Description
fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG?) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924