Search Strains

Intragenic revertant (ra202) of original unc-112 mutation. WBPaper 00005804.

Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

Superficially wild-type. Temperature-sensistive. Maintain at 15C. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Animals are sterile or arrest development as larvae at when grown at 20-25C. Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.

raEx222 [T05G5.1p::M18.3(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx277 [T05G5.1p::M176.4(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

bmdSi284 [loxN::rpl-28p::TIR1(F79G)::T2A::DHB::2xmKate2] I. bmdSi284 is a single copy CRISPR/Cas9 insertion that ubiquitously co-expresses the mutant version of TIR1 for improved auxin-inducible degradation via 5-Ph-IAA and a CDK activity sensor consisting of a fragment of human DNA helicase B (DHB) fused to two copies of mKate2. Reference: Martinez MAQ, et al. Biology Open. 2022 Dec 15;11(12):bio059668. doi: 10.1242/bio.059668.

bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075.

bmdSi282 [^loxN^rgef-1p::mKate2-STOP-STOP-VHH4GFP::DAMc1]. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.

bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Relatively slow growth compared to N2 animals. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.

cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.

cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.

cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.

bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. Ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

icbSi228 [ttTi5605_right::wrt-2p::wCherry::Dam:linker:egl-13NLS::vhhGFP4::unc-54::unc-119 3'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.

icbSi228 [ttTi5605_right::wrt-2p::wcherry::Dam:linker:egl-13NLS:vhhGFP4::unc-54::unc1193'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.

Pick Rollers to maintain. Endogenous N-term tagged DPFF-1 with mNG::AID* using the self-excising cassette for drug selection. Animals are rollers which contains sqt-1 gene. Remove the SEC for normal expression using the protocol described in "Dickinson DJ et al. Genetics. 2015 Aug;200(4):1035-49. doi: 10.1534/genetics.115.178335. Epub 2015 Jun 3. PMID: 26044593."

bmdSi243 (LoxN + cdh-3p::TIR1::F2A::DHB::2xmTurquoise2) I. bmdSi243 is a MosSCI insertion. mNG tag inserted into the C-temrinus of the endogenous unc-34 locus. mKate2 tag inserted into the C-temrinus of the endogenous lam-2 locus.

bmdSi327 [loxN::ckb-3p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. Uterine-specific expression of FLPase in Z1/Z4 and their descendants with blue fluorescent histone reporter for visualization. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi346 [loxN::lin-31p::FLP]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi297 [loxN::rpl-28p::FRT3::STOP::FRT3::TIR1(F79G)::T2A::DHB::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in VPCs. High levels of TIR1(F79G) expression in vulval precursor cells by lin-31p::FLP with co-expression of CDK activity sensor. bmdSi297 contains the ubiquitous rpl-28 promoter driving expression of FRT3::STOP::FRT3::TIR1(F79G)::DHB construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi348 [loxN::rgef-1p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. Pan-neuronal expression of FLPase with blue fluorescent histone reporter for visualization. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi350 [loxN::wrt-2p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. Hypodermal (seam cell) expression of FLPase with blue fluorescent histone reporter for visualization. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi338 [^SEC^lin-29p::FLP::p2A::H2B::2xmTurq2] I. qyIs225 [cdh-3p::mCherry::moeABD] V. Pick Rollers to maintain. Wild-type growth and movement. mNG tag inserted into endogenous lam-2 locus. Anchor cell-specific FLP for targeted protein degradation. Reference: Xiao Y, et al. Genetics. 2023 PMID: 36722258.

bmdSi348 [loxN::rgef-1p::FLP::P2A::H2B::2xmTurq2]; inserted into safe harbor site ttTi4348 in Chr I. bmdSi362 [loxN::rpl-28p::FRT3-LCK::mNG-STOP::FRT3::TIR1(F79G)::2A::PH::2xmKate2]; inserted into safe harbor site ttTi5605 in Chr II. FLP-ON::TIR1 system for AID-tagged protein degradation in neurons. High levels of TIR1(F79G) expression in neurons by rgef-1p::FLP with co-expression of membrane markers. bmdSi362 contains the ubiquitous rpl-28 promoter driving expression of FRT3-LCK::mNG-STOP::FRT3::TIR1(F79G)::2A::PH::2xmKate2 construct dependent upon tissue-specific FLPase. High levels of TIR1(F79G) can be expressed in specific tissue or cell types via FLPase activity, allowing spatiotemporally-targeted degradation of AID-tagged proteins. Reference: Xiao Y, et al. An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in C. elegans. bioRxiv 2022.10.14.512315; doi: https://doi.org/10.1101/2022.10.14.512315

bmdSi363 [^SEC^ser-2p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.

More resistant to alpha-amanitin than ama-1(m118). Will grow in the presence of 0.5% triton-X 100 with 100 ug/ml amanitin whereas ama-1(m118) will not. DR1099 displays temperature-sensitive defects consistent with defective RNA Pol II function. Sterile at 25C (maternal effect sterile). Fertile at 20C, but produces few viable progeny (~80% eggs that do not hatch). Periodically check for Emb to prevent spontaneously suppressed animals from taking over a population. Reference: Rogalski TM, et al. Genetics. 1990 Dec;126(4):889-98.

Paralyzed Unc. sus-1 suppresses the ability of eDp23 to suppress unc-15. eDp23 = sup-3(e1407).

daf-d. Weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele.

Dauer defective.

Temperature sensitive dauers. Paralyzed Unc. sus-1 suppresses the ability of eDp23 to suppress unc-15. eDp23 = sup-3(e1407).

Severly paralyzed Unc. More severe than unc-15 alone.

Severly ill and paralyzed. Lays few eggs. More severe than unc-15 alone.

Hypercontracted and amanitin resistant.

Heterozygotes are semi-Unc and segregate semi-Unc and Vul and dead eggs. (Does not segregate Unc homozygotes because linked to the unc is a lethal in the amanitin gene.)

Dpy phenotype ranges from very tiny to normal dpy-13. Resistant to alpha-amanitin.

Temperature sensitive. Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in mid-larval stages at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.

Temperature sensitive . Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead eggs and Dpys. Dpys are sterile adults at 15C and 20C. Dpys are early larval lethals at 25C.

Heterozygotes are WT and segregate WT, Vul, Dpy and dead eggs. Dpys produce progeny at 15C and 20C, but are sterile at 25C. Strain is sensitive to alpha-amanitin.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLet.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are sterile adults. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. Lethal mid-larval. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are adult steriles. Maintain by picking semi-Dpy.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adult steriles. Maintain by picking semi-Dpy.

Heterozygotes are WT and segregate WT, Vul and Lethals.

Heterozygotes are Dpy and segregate Dpy, Vul and dead eggs. Homozygous dpy-13 ama-1 animals are embryonic lethals. Strain is sensitive to alpha-amanitin.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. Lethal early larval. Maintain by picking semi-Dpy.