More Fields
Strain Species Genotype
CB152 C. elegans unc-5(e152) IV. Show Description
Unc.
UL8 C. elegans leIs8. Show Description
leIs8 [unc-5::lacZ + rol-6(su1006)]. Rollers. B-galactosidase expression was observed in the spermathecaeand the three rectal epithelial cells. Staining in the rectal area first observed in L1 larvae whilst expression in the spermathecae appeared as the structure formed in L4 larvae. Variable staining was also seen throughout the uterus. In the mature gonad staining appeared to be in two sets of two toroidal epithelial cells Ut-1 and Ut-2. Staining was also observed in the large H shpaed Use cell which attaches the uterus to the seam cells and the four epithelial cells Ut-1 and Ut-2. The Uv cells did not appear to stain. Individual worms often just showed one component of this expression. In males the expression was observed to be displayed in all or part of the procodeum. plasmid name: pUL#38E12. plasmid backbone: pPD22.11. Partial Sau3A fragments cloned into BamH1 site of vector.
FX30203 C. elegans tmC25 [unc-5(tmIs1241)] IV. Show Description
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30257 C. elegans tmC25 [unc-5(tm9708)] IV. Show Description
Break points: In(mak-2 unc-8 In(kvs-5 dmd-9)) IV. Covered region (Mb) 6.5 (0.7..7.2) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
NC1730 C. elegans unc-5(e152) IV; wdIs52. Show Description
wdIs52 [F49H12.4::GFP + unc-119(+)]. PVD defects in primary branch guidance, number of secondary branches, and tertiary branches are longer than wild-type.
CB1039 C. elegans unc-5(e53) IV; nuc-1(e1392) X. Show Description
Unc. DNAse undetectable. Gut DNA fluoresence abnormal. M-MATING-NO SUCCESS.
DLW14 C. elegans unc-5(lib1[myo-3p::GFP(-) + unc-119(+) + myo-2p::GFP(Mos1)]) IV; krIs14 V. Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008
DR169 C. elegans che-3(e1378) I; unc-5(e53) IV. Show Description
Dauer defective. Unc-coiler.
DR170 C. elegans unc-5(e53) IV; che-2(e1033) X. Show Description
Dauer defective. Unc-coiler.
DR640 C. elegans ama-1(m118) unc-5(e53) IV. Show Description
Hypercontracted and amanitin resistant.
JK3087 C. elegans ehn-3(q689) unc-5(e53) IV. Show Description
Unc. About 20% have single gonad arm. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK551 C. elegans unc-5(e53) fem-3(q22) IV. Show Description
Temperature sensitive. At 25C, XX germline makes only sperm; at 15C, germline makes oocytes and excess sperm. Unc. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT3918 C. elegans unc-5(e53) sem-3(n1655) IV. Show Description
MT4867 C. elegans unc-5(e53) lin-45(n2018) IV. Show Description
Unc. n2018 is cold sensitive. Most animals at 15C are Vul/Let. AT 25C, 25% of the animals are non-Vul.
MT5241 C. elegans unc-5(e53) unc-44(e362) IV. Show Description
Unc.
MT5242 C. elegans unc-5(e53) bli-6(sc16) IV. Show Description
Blistered Unc.
RU51 C. elegans let-23(n1045) II; unc-5(e53) IV. Show Description
Unc and Vul.
SP1052 C. elegans dpy-13(e184) unc-5(e53) IV. Show Description
DpyUnc.
TH11 C. elegans unc-5(e53) dpy-20(e1282) IV. Show Description
Unc. ts Dpy.
WM103 C. elegans unc-5(e53) mbk-2(ne3442) IV. Show Description
Unc. Maintain at 15C. Produces dead eggs at 25C.
CGC63 C. elegans unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC71 C. elegans unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs57] V. Show Description
umnIs57 [myo-2p::mKate2 + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
MT1000 C. elegans unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT.
VC36 C. elegans unc-5(gk29) pmk-2(gk21)/nT1 IV; +/nT1 V. Show Description
F42G8.3. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk21 hermaphrodites (L1 arrest). gk21 appears to be linked to an uncharacterized unc-5 lesion: complementation tests with unc-5/+; dpy-11/+ males produced viable Unc-5 male and hermaphrodite progeny. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
BC369 C. elegans unc-5(e152) let-55(s45) unc-22(s7)/unc-5(e152) IV. Show Description
Heterozygotes are Unc and segregate Unc and Lethal Unc Twitchers. Lethal early larval. Heterozygotes twitch in 1% nicotine.
CB3695 C. elegans fem-1(e1965)/unc-5(e53) mor-2(e1125) IV. Show Description
WT heterozygote, fem-1(e1965) maternal. Segregates WT heterozygotes, WT fem-1 homozygotes that give only fertile female progeny, and UncMor. (Probably has lost mor-2 [Edgley, 4/92]. When confirmed, should be given a new strain name.)
CB4457 C. elegans fem-1(e2342) / unc-5(e53) mor-2(e1125) IV. Show Description
Wild-type hermaphrodites segregating WT, Fem, Unc Mor. Maintain by picking wild-type hermaphrodites. Deletion allele of fem-1, with unusual maternal effect. Reference: Spence AM, et al. Cell. 1990 Mar 23;60(6):981-90. Johnson CL & Spence AM.. Science. 2011 Sep 2;333(6047):1311-4.
CGC11 C. elegans unc-5(e53)/nT1 [umnIs1] IV; dpy-11(e224)/nT1 V. Show Description
umnIs1 [eft-3p::GFP + HygroR, V:~2821000] V. umnIs1 GFP is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking GFP+ WT. Derived by insertion of GFP transgene into parental strain MT1000 using MosSCI.
CGC13 C. elegans unc-5(e53)/nT1 [umnIs3] IV; dpy-11(e224)/nT1 V. Show Description
umnIs3 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] IV. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT with tdTomato expression. Derived by insertion of tdTomato transgene into parental strain MT1000 using CRISPR/Cas9.
CGC33 C. elegans unc-5(e53)/nT1 [umnIs22] IV; dpy-11(e224)/nT1 V. Show Description
umnIs22 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC39 C. elegans unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs28] V. Show Description
umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
MT464 C. elegans unc-5(e53) IV; dpy-11(e224) V; lon-2(e678) X. Show Description
Mapping strain. DpyUnc.
MT5240 C. elegans unc-5(e53) lin-33(n1043) bli-6(sc16) IV. Show Description
Unc. Vul. Blistered.
RG3197 C. elegans Y54G2A.75(ve697[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. Show Description
Homozygous larval lethal. Deletion of 635 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve697 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ccgaaatgccgcatcgcgtgttgtttagcc; Right flanking sequence: TGGAGCTCGTAAAGGACGTGGTCTTGTCAT. sgRNA #1: atcgcgtgttgtttagccag; sgRNA #2: ATCATCGAGACGGTCTATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW3616 C. elegans deb-1(st554)/unc-5(e53) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs and Pats. Maintain by picking WT and checking for correct segregation of progeny. Received new stock from Waterston lab 5/98. st554 previously called pat-8.
VC362 C. elegans unc-5(e53) IV/nT1 [qIs51] (IV;V); dpy-11(e224) V/nT1 [qIs51] (IV;V). Show Description
Morphological markers unc-5 and dpy-11 balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested nT1 aneuploid progeny, and GFP- unc-5; dpy-11 homozygotes. nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
EU84 C. elegans unc-5(e53) skn-1(zu67) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs.
RG3115 C. elegans vha-11(ve615[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25[unc-5(tm9708)]. Show Description
Homozygous Emb. Deletion of 5698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP unc-5(tm9708) homozygotes, and GFP+ dead embryos(ve615).
RG3193 C. elegans cct-8(ve693[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. Show Description
Homozygous larval lethal. Deletion of 5958 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ dead larvae (ve693 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: CACGTGGTTTTGGTCCTCCAGTCGCCTGCT ; Right flanking sequence: CGGTTCCTTTGAAGTGCTGAGCTCCTTCCT. sgRNA #1: TCAGATTATTATGTCAAAGC; sgRNA #2: GCACTTCAAAGGAACCGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
BC964 C. elegans let-56(s46) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. Show Description
Heterozygotes are WT and segregate more WT, DpyUncs and Lethal Twitchers. Lethal late larval. Heterozygotes Twitch in 1% Nicotine. Pick WT to maintain.
BC965 C. elegans let-59(s49) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Lethal Twitchers. Lethal early larval. Hets twitch in 1% Nicotine. Pick WT to maintain.
BC966 C. elegans let-60(s59) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, and Lethal Twitchers. Lethal mid-larval (leaky). Heterozygotes twitch in nicotine.
WU57 C. elegans lin-45(n2510) unc-24(e138)/unc-5(e53) dpy-20(e1282) IV. Show Description
Heterozygotes are non-Unc and segregate non-Unc, Sterile Unc, and Dpy Unc. n2510 is a strong lin-45 raf allele: 100% of homozygotes are Sterile and Vul (no discernable vulva) or larval lethal.
BC3119 C. elegans unc-5(e152) unc-22(s7) let-99(s1201) unc-31(e169) IV/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Egl, UncLet (maternal effect lethal) and dead eggs. Maintain by picking WT.
DR690 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-272(m243) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLet.
DR691 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-287(m244) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are sterile adults. Maintain by picking semi-Dpy.
DR692 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-275(m245) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. Lethal mid-larval. Maintain by picking semi-Dpy.
DR694 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-281(m247) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
DR695 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-285(m248) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adult steriles. Maintain by picking semi-Dpy.
DR703 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-274(m256) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. Lethal early larval. Maintain by picking semi-Dpy.