MT6205 |
C. elegans |
cha-1(n2411) IV. Show Description
Coiler.
|
|
PR1152 |
C. elegans |
cha-1(p1152) IV. Show Description
Structural gene for choline acetyltransferase (ChAT). Slow growing. Unc-coils, jerky going backward. Small. Resistant to aldicarb and trichlorfon. 99% reduced choline acetyltransferase. Complex complementation pattern with unc-17.
|
|
PR1158 |
C. elegans |
cha-1(b401) IV. Show Description
Temperature sensitive. Unc-difficulty in crawling backwards. Behavior phenotype more pronounced at 25C than at 16C or 20C. Trichlorfon resistant. This strain replaced strain DH401 because Mike Nonet tested DH401 and found it didn't contain cha-1, but did have an unc-11 mutation (5/97).
|
|
PR1162 |
C. elegans |
cha-1(p503) IV. Show Description
Mild (leaky) allele of cha-1. Has approximately 10% WT ChAT activity. Behaviorally normal-normal growth and development. Males mate. Sensitive to cholinesterase inhibitor aldicarb.
|
|
RM777 |
C. elegans |
cha-1(md39) IV. Show Description
Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, no long-term survival. The animals rapidly respond to temperature shift in either direction, even after more than an hour at the non-permissive temperature. Amino acid change: A499D Sequence data: AGAAAGCTGGAATTATTTAAGAAGG / C>A / TGTGCTCAAGCAGGTCAAGGTCACG (in direction of transcription). Reference: Rand JB. Genetics. 1989 May;122(1):73-80.
|
|
TN101 |
C. elegans |
cha-1(cn101) IV. Show Description
|
|
TY1652 |
C. elegans |
cha-1(y226) IV. Show Description
Temperature sensitive. Wild type at 15C; lethal at 22.5C.
|
|
MT3516 |
C. elegans |
lin-1(e1275) cha-1(p1152) IV. Show Description
Temperature sensitive Multi-vulva. Slow growing. Unc-coils, jerky going backward. Small.
|
|
PJ1046 |
C. elegans |
cha-1(p1182) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc lethal at 25C. Difficult to score <25C.
|
|
PJ1164 |
C. elegans |
cha-1(p1182) IV; ccIs55 V; jIs1. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. jIs1 [myo-3::GFP + rol-6(su1006)]. jIs1 likely maps to LGI, LGII, or LGX. Rollers; not all animals roll well.
|
|
RM1743 |
C. elegans |
cha-1(md39) cho-1(tm373) IV. Show Description
Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, lethal. References: Rand JB. Genetics. 1989 May;122(1):73-80. Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.
|
|
PJ1055 |
C. elegans |
cha-1(p1182) IV; unc-68(r1162) ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Slow movement at 25C; might not curl like cha-1 typically does. Very slow movement at 20C. unc-68 channel null.
|
|
VC1836 |
C. elegans |
cha-1(ok2253) IV/nT1 [qIs51] (IV;V). Show Description
ZC416.8b. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2253 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGACTGACACGCCAATTTTT. External right primer: TGCAATGGCCAAAATGACTA. Internal left primer: CGAGCTCATCGAAAACTTCC. Internal right primer: CCCAAGCCTAAGCCTAAACC. Internal WT amplicon: 2862 bp. Deletion size: 1712 bp. Deletion left flank: ACCGTATATCTACAGTACCCCTACATCACT. Deletion right flank: TGCAAAATATTTCTGTGAGAGGTAATTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
DR697 |
C. elegans |
cha-1(m324) dpy-13(e184) ama-1(m118)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and Lethals.
|
|
RM523 |
C. elegans |
unc-17(cn355) IV. Show Description
cn355 behaves like other unc-17 hypomorphs (coily Unc, slow growth, aldicarb-resistant, etc.); however, the mutation is in the splice site necessary for generating unc-17 transcripts, so that unc-17 transcripts and UNC-17 protein are dramatically reduced (hence the unc-17 behavioral phenotypes), and the cha-1 transcripts, CHA-1 protein, and ChAT enzyme activity are significantly increased (Mathews et al., 2015). Note: UNC-17 and CHA-1 protein sequences are both completely wild-type; the phenotypes derive from the extremely low level of the (wild-type) UNC-17 protein. Flanking Sequences: AAATTTAGAAAAAATAAAATATTCC/ A>G /GGGGGAGAGAGAGAGATGGGCTTCA (in direction of transcription). Reference: Mathews EA, et al. Genetics. 2015 Mar;199(3):729-37.
|
|