More Fields
Strain Species Genotype
CB1039 C. elegans unc-5(e53) IV; nuc-1(e1392) X. Show Description
Unc. DNAse undetectable. Gut DNA fluoresence abnormal. M-MATING-NO SUCCESS.
CB3695 C. elegans fem-1(e1965)/unc-5(e53) mor-2(e1125) IV. Show Description
WT heterozygote, fem-1(e1965) maternal. Segregates WT heterozygotes, WT fem-1 homozygotes that give only fertile female progeny, and UncMor. (Probably has lost mor-2 [Edgley, 4/92]. When confirmed, should be given a new strain name.)
CB4457 C. elegans fem-1(e2342) / unc-5(e53) mor-2(e1125) IV. Show Description
Wild-type hermaphrodites segregating WT, Fem, Unc Mor. Maintain by picking wild-type hermaphrodites. Deletion allele of fem-1, with unusual maternal effect. Reference: Spence AM, et al. Cell. 1990 Mar 23;60(6):981-90. Johnson CL & Spence AM.. Science. 2011 Sep 2;333(6047):1311-4.
CB4760 C. elegans fem-1(e2044) mor-2(e1125) unc-24(e158) fem-3(q20) / unc-5(e53) dpy-20(e1282) IV Show Description
Wild-type hermaphrodites segregating wild-type hermaphrodites, Unc-24 females, Unc Dpy hermaphrodites. Maintain by picking wild-type hermaphrodites. Deletion allele of fem-1, with unusual maternal effect. Reference: Spence AM, et al. Cell. 1990 Mar 23;60(6):981-90. Johnson CL & Spence AM.. Science. 2011 Sep 2;333(6047):1311-4.
CGC11 C. elegans unc-5(e53)/nT1 [umnIs1] IV; dpy-11(e224)/nT1 V. Show Description
umnIs1 [eft-3p::GFP + HygroR, V:~2821000] V. umnIs1 GFP is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking GFP+ WT. Derived by insertion of GFP transgene into parental strain MT1000 using MosSCI.
CGC13 C. elegans unc-5(e53)/nT1 [umnIs3] IV; dpy-11(e224)/nT1 V. Show Description
umnIs3 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] IV. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT with tdTomato expression. Derived by insertion of tdTomato transgene into parental strain MT1000 using CRISPR/Cas9.
CGC33 C. elegans unc-5(e53)/nT1 [umnIs22] IV; dpy-11(e224)/nT1 V. Show Description
umnIs22 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC39 C. elegans unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs28] V. Show Description
umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC63 C. elegans unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC71 C. elegans unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs57] V. Show Description
umnIs57 [myo-2p::mKate2 + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
DR169 C. elegans che-3(e1378) I; unc-5(e53) IV. Show Description
Dauer defective. Unc-coiler.
DR170 C. elegans unc-5(e53) IV; che-2(e1033) X. Show Description
Dauer defective. Unc-coiler.
DR640 C. elegans ama-1(m118) unc-5(e53) IV. Show Description
Hypercontracted and amanitin resistant.
DR690 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-272(m243) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLet.
DR691 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-287(m244) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are sterile adults. Maintain by picking semi-Dpy.
DR692 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-275(m245) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. Lethal mid-larval. Maintain by picking semi-Dpy.
DR694 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-281(m247) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
DR695 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-285(m248) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adult steriles. Maintain by picking semi-Dpy.
DR703 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-274(m256) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. Lethal early larval. Maintain by picking semi-Dpy.
DR705 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-282(m258) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
DR706 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-280(m259) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
DR709 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-279(m261) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
DR710 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-277(m262) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpys, Uncs and Lets. Lethal mid-larval. Maintain by picking semi-Dpy.
DR711 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-273(m263) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
DR715 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-284(m267) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
DR717 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-286(m269) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adults which lay eggs that do not hatch. Maintain by picking semi-Dpy.
DR767 C. elegans unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-288(m306) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. DpyLets are adult steriles. Maintain by picking semi-Dpy.
EU84 C. elegans unc-5(e53) skn-1(zu67) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs.
JK1223 C. elegans lag-2(q411) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. [Used to be listed in Kimble lab as unc-5(e53); lag-2(q411 dpy-11(e224)/DnT1. Needs to be checked.] Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3087 C. elegans ehn-3(q689) unc-5(e53) IV. Show Description
Unc. About 20% have single gonad arm. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK551 C. elegans unc-5(e53) fem-3(q22) IV. Show Description
Temperature sensitive. At 25C, XX germline makes only sperm; at 15C, germline makes oocytes and excess sperm. Unc. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT1000 C. elegans unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT.
MT2867 C. elegans unc-36(e251) III; unc-5(e53) IV; dpy-11(e224) V; lon-2(e678) lin-15B&lin-15A(n765) X. Show Description
MT3918 C. elegans unc-5(e53) sem-3(n1655) IV. Show Description
MT464 C. elegans unc-5(e53) IV; dpy-11(e224) V; lon-2(e678) X. Show Description
Mapping strain. DpyUnc.
MT4867 C. elegans unc-5(e53) lin-45(n2018) IV. Show Description
Unc. n2018 is cold sensitive. Most animals at 15C are Vul/Let. AT 25C, 25% of the animals are non-Vul.
MT5240 C. elegans unc-5(e53) lin-33(n1043) bli-6(sc16) IV. Show Description
Unc. Vul. Blistered.
MT5241 C. elegans unc-5(e53) unc-44(e362) IV. Show Description
Unc.
MT5242 C. elegans unc-5(e53) bli-6(sc16) IV. Show Description
Blistered Unc.
RU51 C. elegans let-23(n1045) II; unc-5(e53) IV. Show Description
Unc and Vul.
RW3616 C. elegans deb-1(st554)/unc-5(e53) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs and Pats. Maintain by picking WT and checking for correct segregation of progeny. Received new stock from Waterston lab 5/98. st554 previously called pat-8.
SP1052 C. elegans dpy-13(e184) unc-5(e53) IV. Show Description
DpyUnc.
TH11 C. elegans unc-5(e53) dpy-20(e1282) IV. Show Description
Unc. ts Dpy.
VC362 C. elegans unc-5(e53) IV/nT1 [qIs51] (IV;V); dpy-11(e224) V/nT1 [qIs51] (IV;V). Show Description
Morphological markers unc-5 and dpy-11 balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested nT1 aneuploid progeny, and GFP- unc-5; dpy-11 homozygotes. nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
WM103 C. elegans unc-5(e53) mbk-2(ne3442) IV. Show Description
Unc. Maintain at 15C. Produces dead eggs at 25C.
WU57 C. elegans lin-45(n2510) unc-24(e138)/unc-5(e53) dpy-20(e1282) IV. Show Description
Heterozygotes are non-Unc and segregate non-Unc, Sterile Unc, and Dpy Unc. n2510 is a strong lin-45 raf allele: 100% of homozygotes are Sterile and Vul (no discernable vulva) or larval lethal.
CB538 C. elegans unc-1(e538) X. Show Description
Recessive. Kinker Unc.
GS1214 C. elegans sel-12(ar171) unc-1(e538) X. Show Description
Egl. Unc. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
IE53215 C. elegans ttTi53215 V. Show Description
Homozygous.
RG3030 C. elegans C46F4.3(ve530[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.