More Fields
Strain Species Genotype
DR512 C. elegans che-11(m162) V. Show Description
MQ770 C. elegans tpk-1(qm162) III. Show Description
Maternal effect slow growing.
WM162 C. elegans prg-2(tm1094) IV. Show Description
PFR60 C. elegans hpl-1(tm1624) X. Show Description
Wild type phenotype.
RM1620 C. elegans snt-1(md220) II. Show Description
snt-1(md220) is a 9-bp deletion in exon 5 removing V312-L314. Breakpoints: ggtacgtcccaactgctggtaaattgacag / / tggaagcaaaaaatcttaagaaaatggacg. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.
RM1625 C. elegans snt-1(md259) II. Show Description
snt-1(md259) is a 2-bp deletion in exon 6A. Breakpoints: tttcattttctggggtaattttcagatcct / / tgtgaagattgtgttgatgcaaggtggaaa. Reference: Mathews EA, et al. Mol Cell Neurosci. 2007 Apr;34(4):642-52.