More Fields
Strain Species Genotype
AWR41 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I. Show Description
N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR45 C. elegans pals-22(kea8[pals-22::GFP::degron]) III. Show Description
C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR54 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of eft-3p::TIR1::mRuby allows auxin-inducible degradation of LIN-35 in somatic tissues. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR56 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi64 II. Show Description
ieSi64 [gld-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of gld-1p::TIR1::mRuby allows for auxin inducible degradation of LIN-35 in the germline. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR58 C. elegans lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; keaSi10 II. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of LIN-35 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.]
AWR59 C. elegans keaSi10 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of PALS-22 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR61 C. elegans keaSi11 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi11 [vit-2p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of vit-2p::TIR1::mRuby allows for auxin inducible degradation in the adult intestine. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR62 C. elegans keaSi9 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi9 [myo-3p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of myo-3p::TIR1::mRuby allows for auxin inducible degradation in the body wall muscles. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR63 C. elegans keaSi12 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
keaSi12 [dpy-7p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of dpy-7p::TIR1::mRuby allows for auxin inducible degradation in the epidermis. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
AWR64 C. elegans kea15 II; pals22(kea8[pals-22::GFP::degron]) III. Show Description
kea15 [rgef-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rgef-1p::TIR1::mRuby allows for auxin inducible degradation in neurons. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.]
BFF68 C. elegans mjIs134 II; hrde-1(pig6[degron::ha::hrde-1]) III. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala/his-58/tbb-2 3'UTR + Cbr-unc-119(+)] II. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. gfp fluorescence in germline (mex-5::gfp). Control strain for BFF69; does not carry TIR1 transgene necessary for the degradation. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.
BFF69 C. elegans mjIs134 II; hrde-1(pig6[degron::ha::hrde-1]) III; ieSi38 IV. Show Description
mjIs134 [mex-5p::GFP::(Gly)5Ala/his-58/tbb-2 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. N-terminal Auxin-Inducible Degron and HA tag inserted into the endogenous hrde-1 locus. Germline-expressed TIR1 and germline GFP. Allows for the degradation of hrde-1 and heritable RNAi deficiency in the presence of auxin. hrde-1(pig6) crRNA sequence: CAUAAUUUUGUCGAGCAAGU. Reference: Toker IA, et al. Dev Cell. 2022 Feb 7;57(3):298-309.e9. PMID: 35134343.
BS5633 C. elegans ieSi64 II; lag-1(oz536oz537[lag-1::degron::3xHA]) IV. Show Description
ieSi64 [gld-1p::TIR1::mRuby::gld-1 3'UTR + Cbr-unc-119(+)] II. Essentially wild-type when maintained on NGM plates. All germline stem cells enter into meiosis when treated with Auxin (1mM). References: Chen J, et al. PLoS Genet. 2020 Mar 20;16(3):e1008650. PMID: 32196486. Chen J, et al. 2020 MicroPublication (https://doi.org/10.17912/micropub.biology.000310) .
CA1202 C. elegans ieSi57 II; ieSi58 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. ieSi57 is a single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. This strain can be used as control for auxin-inducible degradation (AID) in somatic tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1203 C. elegans ieEx21. Show Description
ieEx21 [smu-2p::degron::smu-2::GFP::smu-2 3'UTR + rol-6(su1006)]. Rollers. Pick Rollers to maintain array. Rollers carry a transgene expressing degron- and GFP- tagged SMU-2 in both the soma and the germ line. This strain can be combined with different TIR1 strains to test auxin-inducible degradation (AID) of nuclear protein in various tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1204 C. elegans unc-119(ed3) III; ieSi58 IV. Show Description
ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. This strain can be combined with different TIR1 strains to test auxin-inducible degradation (AID) of protein in somatic tissue. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1205 C. elegans unc-119(ed3) III; ieSi59 III. Show Description
ieSi59 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] III. Single copy transgene inserted into chromosome III (oxTi444) expressing degron::GFP at low levels in the soma. This strain can be combined with different TIR1 strains to test auxin-inducible degradation (AID) of protein in somatic tissue. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1206 C. elegans ieSi57 II; ieSi59 III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi59 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] III. ieSi57 is a single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. ieSi59 is a single copy transgene inserted into chromosome III (oxTi444) expressing degron::GFP at low levels in the soma. This strain can be used as control for auxin-inducible degradation (AID) in somatic tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1207 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I. Show Description
A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be combined with different TIR1 strains to examine spatial and temporal requirements for dynein, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1210 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in somatic tissue, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1212 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi60 II. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in pharyngeal muscle. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in pharyngeal muscle, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1213 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi61 II. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used to examine spatial and temporal requirements for dynein in the intestine, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1215 C. elegans dhc-1(ie28[dhc-1::degron::GFP]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. A degron::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in the germ line and early embryos, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.
CA1216 C. elegans air-2(ie31[degron::GFP::air-2]) I. Show Description
Degron and GFP tag inserted into endogenous air-2 gene locus by CRISPR/Cas9 engineering. Reference: Divekar NS, et al. PLoS Genet. 2021 May 20;17(5):e1009567. PMID: 34014923
CA1217 C.elegans air-2(ie31[degron::gfp::air-2]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Degron and GFP tag inserted into endogenous air-2 gene locus by CRISPR/Cas9 engineering allows auxin-inducible degradation (AID) of AIR-2 in germ line and early embryos. Reference: Divekar NS, et al. PLoS Genet. 2021 May 20;17(5):e1009567. PMID: 34014923
CL2337 C. elegans smg-1(cc546) I; dvIs38. Show Description
dvIs38 [myo-3p::GFP::degron::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Rollers. Temperature-dependent expression of aggregating GFP in body wall muscle (weak at 16C, strong at 25C). Animals become paralyzed if upshifted as larvae to 25C due to expression of aggregating GFP. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
DQM1118 C. elegans icbSi228 II; unc-119(ed3) III; ama-1(ers49[ama-1::degron::gfp]) IV. Show Description
icbSi228 [ttTi5605_right::wrt-2p::wCherry::Dam:linker:egl-13NLS::vhhGFP4::unc-54::unc-119 3'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.
ERC102 C. elegans ieSi57 II; smc-3(syb5520[smc-3::GGGGS::AID::emGFP]) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. Degron and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX5520 with CA1200. Reference: https://www.biorxiv.org/content/10.1101/2023.09.18.558239v1.
ERC103 C. elegans ieSi57 II; wapl-1(syb6035[wapl-1::GGGGS::AID::emGFP]) IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. Degron and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX6035 with CA1200. Reference: https://www.biorxiv.org/content/10.1101/2023.09.18.558239v1.
ERC82 C. elegans ieSi57 II; ers54[dpy-27::degron::GFP] III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron::GFP tag inserted into the endogenous dpy-27 locus. Dumpy, Him, X chromosome dosage compensation hypomorph. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
ERC83 C. elegans ieSi57 ers55[top-2::degron::GFP] II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted into the endogenous top-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
ERC84 C. elegans top-1(ers56[top-1::degron::GFP]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted at the end of exon five in the endogenous top-1 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
FGP29 C. elegans gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I; ieSi38 IV. Show Description
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
FGP30 C. elegans gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I; ltIs37 IV. Show Description
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
HML1012 C. elegans cshIs140 II; ieSi58 IV. Show Description
cshIs140 [rps-28p::TIR1(F79G)::T2A::mCherry::his-11 + Cbr-unc-119(+)] II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Ubiquitously expressed single copy, modified TIR1 allele, TIR1(F79G) that is compatible with 5-PH-IAA and can be used to deplete auxin-induced degradation-tagged (AID-tagged) proteins. Efficiently depletes target proteins at 1µM 5-Ph-IAA. Nuclear localized mCherry co-expression marker.
HML1035 C. elegans cshIs128 II; ieSi58 IV. Show Description
cshIs128 [rps-28p::TIR1::T2A::mCherry::his-11 + Cbr-unc-119(+)] II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Companion strain to HML1012. Harbors conventional allele of TIR1 and Nuclear localized mCherry co-expression marker.
HS3545 C. elegans osIs158 II; ieSi58 IV. Show Description
osIs158 [eft-3p::ccvTIR-1(F79G)::mRuby] single copy inserted into ttTi5605 on LG II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.
HS3750 C. elegans ieSi58 IV; osIs182 V. Show Description
ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. osIs182 [eft-3p::AtTIR1(F79G) + LoxP + myo-2p::GFP + rps-27p::neoR + LoxP] V. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. osIs182 is a single copy insertion of TIR1(F79G) into chromosome V (oxTi365) and expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.
IJ1651 C. elegans mdt-15(yh44[mdt-15::degron::EmGFP]) III. Show Description
Degron and EmGFP tag inserted at the 3' end of the endogenous mdt-15 gene locus by CRISPR/Cas9 engineering. This strain can be used for auxin-inducible degradation (AID) of MDT-15 protein. Reference: Lee D, et al. PLoS Biol. 2019 Aug 13;17(8):e3000415. doi: 10.1371/journal.pbio.3000415. PMID: 31408455.
JEL1197 C. elegans wrdSi3 II; dpy-27(xoe41[dpy-27::AID::myc]) III; him-8(me4) IV. Show Description
wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Endogenous dpy-27 locus tagged with AID element and myc to create a conditional allele using the auxin-inducible degron (AID). In absence of auxin, ~40% of worms are male due to him-8(me4) mutation. In the presence of auxin, ~100% of worms are male (hermaphrodite-lethal due to degradation of AID-tagged DPY-27). Reference: Li Q, et al. Inducible degradation of dosage compensation protein DPY-27 facilitates isolation of Caenorhabditis elegans males for molecular and biochemical analyses. bioRxiv 2022.01.27.478040; doi: https://doi.org/10.1101/2022.01.27.478040.
JTL611 C. elegans hsf-1(ljt3[hsf-1::degron::gfp]) I; ieSi57 II; unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Endogenous hsf-1 tagged with the auxin-inducible-degron and GFP allows depletion of endogenous HSF-1 in the somatic tissues upon auxin treatment. Animals treated with 1mM of auxin when eggs are laid will arrest in L1 or L2 stage. Reference: Edwards SL, et al. Cell Rep. 2021 Aug 31;36(9):109623. PMID2021 Aug 31;36(9):109623. PMID: 34469721
KG5148 C. elegans unc-104(ce833[5xMyc::AID::unc-104+sup-1(e995)]) II. Show Description
The Auxin Inducible Degron (AID) flanked by a 5X Myc/spacer tag on left and a single spacer on the right is fused to the N-terminus of the unc-104 gene. Allows conditional degradation of UNC-104 protein when combined with tissue specific expression of TIR1 in the presence of 1 mM Auxin in plate media. Note: KG5148 does not express TIR1. On standard plates: wild type growth, appearance, and locomotion rate. For animals expressing a TIR1 transgene in the nervous system: Animals that hatch and develop on 1 mM Auxin plates generally remain tightly coiled near the location of hatching and exhibit slow growth (up to 7 days to reach adulthood, with 98% reaching adulthood by 7 days). Adults placed on Auxin abruptly lose about 75% of their locomotion function between 6 and 12 hours after plating. The remaining locomotion function is lost gradually between 12 and 52 hours. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.
MLC1065 C. elegans pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MLC1245 C. elegans drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3XFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MLC1726 C. elegans drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3XFLAG::AID::myc]) pash-1(luc71[pash-1::2xGGSG::3XFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MLC1729 C. elegans drsh-1(luc82[myc::AID::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MQD2356 C. elegans hqSi8 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3’UTR+Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2374 C. elegans ieSi61 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2375 C. elegans daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.
MQD2378 C. elegans hqSi9 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the hypodermis. hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.