| DR697 |
C. elegans |
cha-1(m324) dpy-13(e184) ama-1(m118)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and Lethals.
|
|
| IM324 |
C. elegans |
nid-1(ur41) V; edIs20 X. Show Description
edIs20 [F25B3.3::GFP + rol-6(su1006)]. Rollers. Pan-neuronal GFP expression. ur41 has longitudinal nerve defects.
|
|
| NG324 |
C. elegans |
wsp-1(gm324) IV. Show Description
Low penetrance (about 25%) embryonic lethality and reduced brood size. wsp-1(gm324) is an N-terminal deletion that exhibits no observable mRNA or protein.
|
|
| VC1228 |
C. elegans |
klp-11(tm324) IV. Show Description
331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RM3248 |
C. elegans |
oct-1(gk354) I; cho-1(tm373) IV; chtl-1(ok1695) X. Show Description
Approximately wild-type in appearance, growth, and movement. Reference: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.
|
|