Strain Information
| Name | DM1245 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | unc-112(r367) V; Y102F5A.1(ra238) dim-1(ra204) X. |
| Description | Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org. |
| Mutagen | EMS |
| Made by | Mary Gilbert |
| Laboratory | VC |
Sign in
or
register an account if you want to order this strain.