More Fields
Strain Species Genotype
CB25 C. elegans unc-23(e25) V. Show Description
Unc.
CB324 C. elegans unc-23(e324) V. Show Description
Unc. Head muscles degenerative. Recessive. M-MATING+POOR <1%WT.
CB611 C. elegans unc-23(e611) V. Show Description
Head abnormal. Variable expression. M-MATING+++ 10-30%WT.
RB1301 C. elegans unc-23(ok1408) V. Show Description
H14N18.1 Homozygous. Outer Left Sequence: tgaaagcaaacgagacatcg. Outer Right Sequence: accaccacctgatctcttgc. Inner Left Sequence: ttttctgtctcacggagcct. Inner Right Sequence: ccagaaaagggacaaccgta. Inner Primer PCR Length: 2756. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
DM5130 C. elegans unc-23(e25) V; raEx20. Show Description
raEx20 [unc-23::GFP + rol-6(su1006) + pPD95.75(GFP)]. Rollers. Pick Rollers to maintain. raEx20 encodes a functional GFP::tagged UNC-23 protein. Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.
DM1602 C. elegans hsp-1(ra807) IV; unc-23(e25) V. Show Description
Superficially wild-type. Temperature-sensistive. Maintain at 15C. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Animals are sterile or arrest development as larvae at when grown at 20-25C. Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.
TH37 C. elegans dpy-11(e224) unc-23(e25) V. Show Description
Dpy. Unc.
BW219 C. elegans nDf31/unc-23(e25) sma-1(e30) V. Show Description
Heterozygotes are WT and segregate SmaUnc and Lethals. Lethal in L1. Maintain by picking WT.
RW3570 C. elegans unc-112(st562)/dpy-11(e224) unc-23(e25) V. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Pats. Maintain by picking WT and checking for correction segregation of progeny.
BW1118 C. elegans mel-25(ct60) unc-42(e270)/unc-23(e25) vab-8(e1017) V; lon-2(e678) X. Show Description
Maintain by picking Lon non-Unc. Throws Lon non-Unc, Lon Unc Vab (bent head, tails very thin), and Lon Unc Mel (kinker, temperature-sterile).
BC2179 C. elegans dpy-18(e364)/eT1 III; mDf3/eT1 V. Show Description
Heterozygotes are WT and segregate WT, dead eggs and Unc-36. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. [2/99: Strain may have broken down: doesn't segregate real WT, and those animals that are not Unc-36 still are somewhat Unc; and unc-23 is no longer under mDf3 in this strain. Mike Nonet]
DM2407 C. elegans hsp-1(ra807) IV; dpy-11(e224) V. Show Description
Dpy. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.
DM7020 C. elegans raEx20. Show Description
raEx20 [unc-23::GFP + rol-6(su1006) + pPD95.75(GFP)]. Rollers. Pick Rollers to maintain. raEx20 encodes a functional GFP::tagged UNC-23 protein. Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.
FX19173 C. elegans lig-4(tm750); tmIn19 V. Show Description
Break points: In(unc-23 lon-3) V. Covered region (Mb) 3.3 (8.9..12.2) Lon Unc. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30133 C. elegans tmC3 V. Show Description
Break points: In(unc-83 C27A7.1 In(unc-23 lon-3)) V. Covered region (Mb) 5.7 (6.5..12.2) Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30134 C. elegans tmC3 [egl-9(tmIs1228)] V. Show Description
Break points: In(unc-83 C27A7.1 In(unc-23 lon-3)) V. Covered region (Mb) 5.7 (6.5..12.2) Balancer marked with myo-2p::Venus. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30135 C. elegans tmC3 [egl-9(tmIs1230)] V. Show Description
Break points: In(unc-83 C27A7.1 In(unc-23 lon-3)) V. Covered region (Mb) 5.7 (6.5..12.2) Balancer marked with myo-2p::mCherry. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30152 C. elegans tmC12 [egl-9(tmIs1194)] V. Show Description
Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Balancer marked with myo-2p::Venus. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30153 C. elegans tmC12 [egl-9(tmIs1197)] V. Show Description
Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Balancer marked with myo-2p::mCherry. Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30154 C. elegans tmC12 V. Show Description
Break points: In(hlh-10 C01G10.10 In(unc-23 lon-3)) V. Covered region (Mb) 6.1 (8.9..15.1) Lon Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
VC4382 C. elegans ptr-1(gk5276[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC3[egl-9(tmIs1230)] V. Show Description
Homozygous lethal or sterile deletion balanced by tmC3. Deletion of 2147 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC3 carries myo-2p::mCherry and is Unc-23 Lon-3. Left flanking sequence: GAAAATAGGCAAAAATATTAAACCGTGAAG; Right flanking sequence: GGAAGTGTCATGTTATGATTGACTCCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.