Search Strains

Dark-bodied, unmarked variant of mIn19mC6) with small broods. Presumably balances let-552 to rol-1 (hermaphrodite stock obtained from outcrossing these males to dpy-10 unc-4 was shown to balance this interval). Isolated from DR1982 as a stock that no longer segregated Dpy-10 animals. Not clear whether this strain is the result of chromosome rearrangement in DR1982, or if DR1982 stock was a mixture of mIn1(+)/mIn[dpy-10] and mIn1(+) homozygotes.

WT gross phenotype, with GFP semi-dominantly expressed in 4-60 cell embyros, pharyngeal muscle and gut. Segregates WT, brighter Dpy GFP mIn1 homozygotes and non-GFP bli-2 unc-4 homozygotes. Pharyngeal and gut GFP is easily seen in a UV dissecting microscope; early embryonic signal requires higher magnification. mIs14 occasionally crosses off mIn1[dpy-10], apparently by double recombination. Pick WT, check for GFP and check for correct segregation of progeny to maintain. mIs14 is ccEx9747 integrated into mIn1[dpy-10]. This is a three-construct element containing myo-2 and pes-10 promoters and a gut enhancer fused individually to GFP coding sequence.

Heterozygotes are WT and segregate WT, Lethal Uncs and Roller mIn1 homozygotes. let-552 unc-4 chromosome is well balanced. Rol does not express until late L4/early adult. Pick WT and check for correct segregation of progeny.

Temperature sensitive dauer constitutive. Many dauers at 15C. Dpy. Heterozygotes Roll.

Dauer defective-leaky. Somewhat small. Suppresses daf-2.

Dpy. Heterozygotes Roll. Segregates males. M-MATING-NO SUCCESS.

Moves relatively well. Recessive.

Temperature sensitive Dpy. Penetrance is incomplete. Left hand roller. Roller low penetrance. Grows well at 25C.

Heterozygotes are WT and segregate WT, Vul, and lethals. Lethal early larval. Heterozygotes twitch in 1% nicotine. Well balanced.

Temperature sensititve dauer constitutive. Small. 100% dauers at 25C. 15% dauers at 15C.

Severly ill and paralyzed. Lays few eggs. More severe than unc-15 alone.

Heterozygotes are WT and segregate WT, Vul and dead eggs. Homozygous Df is embryonic lethal. Strain is sensitive to alpha-amanitin. New stock received from Patrice Albert 12/95. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Temperature sensitive dauer constitutive. Small. Amber. Maintain at 15C.

WT phenotype, segregates WT, Egl (age-1 homozygotes) and DpyUncs. Egl animals give all non-recovering dauer larvae (m333 shows maternal effect), with variable radial shrinkage and variable resistance to 1% SDS. Pick WT to maintain and check for correction segregation of progeny. age-1(m333) pka daf-23(m333).

Balanced lethal dauer constitutive. Heterozygotes are WT and segregate WT, LonDaf and Unc. Will get 3-5 adult Lon per clone. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs and Vul (nT1/nT1). Clone WT to maintain. Well balanced. The nT1 homozygotes may overtake the plate at 15C or upon starvation.

Heterozygotes are semi-Dpy and segregate semi-Dpy and dead eggs (mDf7/mDf7, nT1/nT1 and aneuploids). This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle. Rec'd new stock 11/99 from Riddle lab.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle. Rec'd new stock 12/99 from Riddle lab.

Heterozygotes are semi-Dpy and segregate semi-Dpy, early larval lethals and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Non-Twitchers. Still contains Tc1. Temperature sensitive. Sterile at 25C, grows ok at 20C. Dauer larvae are SDS resistant.

Unc-weak kinker, doesn't back well. Temperature sensitive dauer constitutive. Maintain at 15C. Makes high percentage of dauers at 25C. tsp for dauer formation is L1 molt. Type C Egl. Active. Resistant to 1 mM levamisole. Sensitive to hypoosmotic shock.

Animals which carry the Dup are semi-Dpy and segregate semi-Dpy and DpyUnc (animals which have lost the Dup). Animals homozygous for the Dup are slow growing, slender and transparent. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, early larval lethals and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.

Heterozygotes are WT. At 25C the hets segregate DpyDafs, WT and Lon. At 15C the hets segregate Dafs, WT and Lon. [dpy-7(sc27) is temperature sensitive. At 25C it is larger than most Dpys and has a tendency to roll. Not expressed at 15C.] Maintain by picking WT.

T2A::sGFP2(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates sGFP2(1-10) from GLH-1 post-translationally so that sGFP2(1-10) disperses throughout germ cell nuclei and cytoplasm. sGFP2(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Proteins tagged with the 16aa GFP11 or M3 sequence will bind sGFP2(1-10) in the germline and early embryo to emit GFP fluorescence. Broods from DUP223 are similar to wild-type at permissive and restrictive temperatures. Transgene tag was inserted by CRISPR/Cas9 in an N2 background. [NOTE: (04/23/2021) The original stock received by the CGC was found to be carrying a second insertion, clu-1(sam131[GFP(11)::clu-1]. A new stock verified by to be carrying the correct transgene was received from DUP 05/04/2021.] Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Proteins tagged with the 18aa wrmScarlet(11) sequence will bind wrmScarlet(1-10) in the germline and early embryo to emit wrmScarlet fluorescence. Broods from DUP237 are similar to wild-type at permissive and restrictive temperatures. Transgene tag was inserted by CRISPR/Cas9 in an N2 background. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.

Heterozygotes segregate wild-type GFP+ heterozygotes, GFP+ Dpy, and sec-5 homozygotes (scrawny, small broods, abnormal gut appearance) sec-5 is homozygous maternal-effect lethal; M+Z- animals produce a few dead L1-L2 stage larvae with Vab defects. Pick GFP+ wild-type to maintain. Based upon phenotype, pk2357 is a strong loss-of-function, but likely not a null allele; molecular lesion produces a premature stop at position 389. Reference: Frische EW, et al. EMBO J. 2007 Dec 12;26(24):5083-92. [NOTE: This strain was previously described as carrying pk2358, but pk2357 is the correct allele. Both pk2357 and pk2358 cause the same nonsense (amber) change.]

Ubiquitous expression with cytosolic localization. Derived in an N2 background. Detection with triplex primers: HS125 5’-CTTGTCACTGTAAGGGAAGATTTCC-3’ HS126 5’-TTGTCCTCCTCTCCCTTGG-3’ HS127 5’ ACGTAGAATGTTCCAGAGTTCCAG-3' Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501

Gain-of-function allele (G12V). Low penetrance of 3? to 1? fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.

mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501

Ubiquitous expression and localization to plasma membranes. Derived in an N2 background. TD185 5’ -GCCGGAAGAGTGATGAACCC- 3’ TD186 5’ -TAATGAGCTCGGAGACCATGGC- 3’ TD187 5’ -CGCACCTCATCATACATGAACTGC- 3’ Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501

Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP re242 homozygotes (arrested at L3). nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.

mKate GLO (germline optimized) tag inserted at C-terminus of endogenous SCD-1. Red fluorescence in all nuclei. Cas9 guide + PAM: GACTTGGAAGAAGACGGTGG+AGG. Reference: Ailion M, et al. In preparation.

Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. [6/98: Paul De Ley has checked this strain and suggests that it doesn't match the original description of Acrobeloides thornei very well.]

rhIs2 [pat-3::HA::GFP]. rhIs2 contains cosmid-derived full-length pat-3, including 5 kb 5’UTR and 1 kb 3’ UTR, with HA and GFP(S65C) tags inserted prior to the pat-3 stop codon. Reference: Plenefisch JD, et al. Development. 2000 127(6):1197-207. doi: 10.1242/dev.127.6.1197.

qaIs8001 [fhod-1::GFP + unc-119(+)]. Integrated functional translational FHOD-1::GFP fusion. Superficially wild-type. Reference: Mi-Mi L, et al. J Cell Biol. 2012 Jul 9;198(1):87-102. doi: 10.1083/jcb.201202053.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] IV. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. mCherry::PH marks cell membranes. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]

eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-45 3'UTR]. Motility defect. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]

eeEx100 [his-24::GFP + rol-6(su1006)]. Rollers. Nuclear GFP fluorescence detected beginning with the eight-cell stage of the embryo in all somatic nuclei without the P-cell. In adults the GFP signal in somatic cells and in few hermaphrodites in undifferentiated germ nuclei and in oocytes and sperm. About 20% transmission.

eeEx106 [hil-1::GFP + rol-6(su1006)]. GFP expression in body wall muscles, in the vulva sex muscles, in the marginal cells of the pharynx, in a limited number of head neurons, in the cytoplasm of excretory cells. The expression starts in the about 100-cell embryo in a few cells in the periphery in the nucleoplasm and in the nucleoli. Complex extrachromosomal arrary....pick Rollers. About 20% Rollers.

Null allele of ben-1. Benzimidazole resistant. Can be used for benzimidazole resistance studies or selection. Reference: Hahnel SR, et al. PLoS Pathog. 2018 Oct 29;14(10):e1007226. doi: 10.1371/journal.ppat.1007226. PMID: 30372484.

Temperature sensitive. Maintain at 15C. At 25C the animals will arrest at 3-fold/L1 stage. Unc.

Temperature sensitive. At 15C the animals are essentially WT, but with a reduced brood; males mate well. Embryos raised at 25C will result in 3-fold/L1 arrest (Mup). Larval shift to 25C will result in sterile hermaphrodites but males that are fertile.

Dpy suppresses Rol and Lon. Strain appears to be only Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-5 causes extreme dumpiness, rol-6 causes worms to roll over and lie in a "C" shape, and lon-1 worms are about 125% WT length.

oxIs12 [unc-47p::GFP + lin-15(+)]. Integration maps at +2.0 on X. Expression of GFP in all GABAergic neurons.

Severe kinker. Small and scrawny with flaccid little movement. Slow pharyngeal pumping.

Mixed "strain" started from many different worms that emerged from the same apricot that gave rise to strain EG4181. Some worms emerged as dauers, but there were also L4s and adults. Consists of a mix of the worms that came from the apricot to try to maintain as much diversity as possible in the population and thus is not a true strain in the traditional sense. It will be sent as contaminated worms since it cannot be cleaned up without going through a bottleneck. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).