Search Strains

Weakly semi-dominant, temperature sensitive, embryonic lethal mutant. 38% of embyros produced by homozygous mothers at 15C will hatch; 2% produced at 26C will hatch. Mutation is semi-dominant at 26C: 12% of embryos produced by heterozygous mothers hatched at 26C, and about 25% of the survivors were or295/or295, indicating the lethality is semi-dominant and maternal. Mutant embyros exhibit excess cortical actomyosin contractility (extra furrows and protrusions) in early embryonic cells, during interphase and most of mitosis. or295 is a gga to aga substitution (G16R).

orEx1[act-2 promoter::GFP::act-2 genomic fusion + rol-6(su1006)]. Shows cytoplasmic and cortical ACT-2::GFP expression in early embryonic cells, in epidermal cells during embryonic elongation, and in body wall muscle cells and some neurons in adults. All expression is zygotic; no germline expression is detected for this trangene even though act-2 is maternally expressed. Maintain by picking Rollers.

Strain is homozygous viable due to redundancy of act- and act-3 genes. AT 15C, all embyros produced by homozygous mothers hatch; at 26C, 88% of embryos hatch. Deletion which removes 544 nucleotides of act-2 plus the predicted 3' UTR and 705 nucleotides 3' of that. This removes 163/376 amino acids of the act-2 sequence (calculated with ATG methionine included). Sequence of deletion is (text inside of slashes is deleted, with 5' and 3' sequences shown): (exon#2)5'....gtgaaatcgtgcgtgacatc/aaggagaagctttgtt........ ...tggatagacattggtgt/gcgcactccttctggat.....3'(872 nucleotides from stop codon). Removes 489/1131 coding base pairs, beginning in second exon and extending beyond the 3' UTR.

Temperature-sensitive embryonic lethal. Maintain at 15 degrees. 100% dead embryos at 25 degrees. Small, posteriorly displaced first mitotic spindle with defective chomosome segregation and cytokinesis.

Temperature-sensitive embryonic lethal. Maintain at 15 degrees. 100% dead embryos at 25 degrees. Small, posteriorly displaced first mitotic spindle with defective chomosome segregation and cytokinesis.

orIs17 [dhc-1p::GFP::dhc-1 + unc-119(+)]. N-terminal-tagged GFP::dhc-1 fusion driven by the dhc-1 promoter. Reference: O'Rourke SM, et al. Nat Cell Biol. 2010 Dec;12(12):1235-41.

orIs14 [pie-1p::GFP::efa-6c::pie-1 3'UTR + unc-119(+)]. pie-1 promoter-driven N-terminal GFP fusion to EFA-6 isoform C. Reference: O'Rourke SM, et al. Nat Cell Biol. 2010 Dec;12(12):1235-41.

let-99(or204) is temperature-sensitive, maternal-effect, embryonic-lethal. Nearly completely penetrance of lethality at 26C. Viable at 15C. Maintain at 15C. Reference: Goulding MB, et al. J Cell Biol. 2007 Sep 24;178(7):1177-91.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. orIs13 [pie-1p::GFP::npp-22(genomic)::pie-1 3'UTR + unc-119(+)]. GFP-tagged NPP-22. Superficially wild-type. Might still carry unc-119(ed3) in background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: O'Rourke SM, et al. PLoS Genet. 2007 Aug;3(8):e128.

Strain is egg-laying defective. Homozygous mex-3(or20) is a non-conditional maternal effect lethal: worms fill up with dead eggs. Heterozygotes bag with 11/16 dead embryos and larvae. About 10% of worms can lay eggs and be mated into for outcrossing. The mex-3(or20) mutant embryos produce excess body wall muscle anteriorly.

Temperature sensitive. Maintain at 15C. At 26C, animals give rise to 100% dead embryos, with embryos exhibiting lack of pronuclear migration at the one-cell stage. At 15C, animals give rise to viable progeny.

or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets fill up with a mix of dead embryos and larvae [11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2; vulvaless due to homozygous lin-2(e1309) mutation; about 10% of lin-2(e1309) worms are leaky and lay eggs/can be mated into]. The homozygous or28 hermaphrodites fill up with dead embryos. The lin-2 background helps to score embryonic lethality for both heterozygotes and or28 homozygotes. or28 is a G to D mis-sense mutation at amino acid position 123.

or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets fill up with a mix of dead embryos and larvae [11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2; vulvaless due to homozygous lin-2(e1309) mutation; about 10% of lin-2(e1309) worms are leaky and lay eggs/can be mated into]. The homozygous or28 hermaphrodites fill up with dead embryos. The lin-2 background helps to score embryonic lethality for both heterozygotes and or28 homozygotes. Strain produces a lot of males due to him-8(ec56). or28 is a G to D mis-sense mutation at amino acid position 123.

Him. or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123.

or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123. Strain produces lots of males due to him-8(ec56).

Recessive, temperature-sensitive embryonic lethal mutant . Maintain at 15C, most embryos will hatch. Nearly all embryos fail to hatch at 25C. Centrosomes are detached from nuclear spindle envelope in one-cell stage embryos; sometimes reattach to pronuclei; sometimes stay unattached throughout prophase until nuclear envelope breakdown. Mis-sense mutation in Q367P. Hook family member. Localizes to nuclear envelope and centrosomes; interacts with SUN domain proteins at nuclear envelope and interacts with dynein.

Maintain at 15C; sterile at 26C. Shift to restrictive temperature (26C) for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. Reference: Connolly A, et. al. Mol Biol Cell. 2014 Apr;25(8):1298-311.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive. Viable at 15C. Complete loss of aspm-1 function at 26C. Shift to restrictive temperature for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly A, et al. Mol Biol Cell. 2014 Apr;25(8):1298-311. PMID: 24554763

orEx25 [GFP::aspm-1 + unc-119(+)]. Maintain at 25C. Pick non-Unc GFP+ to maintain. GFP might not be visible at low magnification. Reference: Connolly AA, et al. Mol Biol Cell. 2014 Apr;25(8):1298-311.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C; sterile at 26C. Shift to restrictive temperature (26C) for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly A, et. al. Mol Biol Cell. 2014 Apr;25(8):1298-311.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

Heterozygotes are WT and segregates WT, Sterile Dpys, and Unc. Unc worms produce temperature sensitive lethal embryos with centriole duplication defects. Keep at 15˚C to maintain or452 homozygotes. Ref. Sugioka, Hamill, et al., (2016) eLife 6 e20353.

GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. orIs1 [pie-1p::GFP::mei-1 + unc-119(+)]. Maintain at 25C to retain transgene fluorescence. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

qIs26 [lag-2::GFP + rol-6(su1006)]. or1948 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1948 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.

qIs26 [lag-2::GFP + rol-6(su1006)]. or1951 is a CRISPR/Cas9 engineered mutation in cls-1 causing a frameshift and premature stop. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate heterozygotes (WT Rol), lethal qC1 homozygotes, and or1951 homozygotes (lay 100% dead embryos). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. Reference: Schlientz AJ & Bowerman B. (2020) C. elegans CLASP/CLS-2 negatively regulates membrane ingression throughout the oocyte cortex and is required for polar body extrusion. BioRxiv.

ijmSi3 [mex-5p::cls-2(re-encoded)::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The coding sequence of GFP-tagged cls-2 in the transgene was re-coded using silent mutations to render it insensitive to RNAi-depletion of endogenous cls-2 expression. mCherry expression marks histones. Not known if unc-119(ed3) is still carried in the background of this strain. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Schlientz A and Bowerman B. PLoS Genet. 2020 Oct 7;16(10):e1008751. doi: 10.1371/journal.pgen.1008751.

Heterozygotes are WT and segregate WT, Lon males, lots of dead eggs, and Dpys. The Dpys should give all dead embryos at all temperatures. Approximately 60% of these dead embryos make excess mesoderm at the expense of endoderm, due to an E to MS fate transformation. Embryonic lethality is 100% penetrant for or46.

Heterozygotes are WT and segregate WT, Lon males, lots of dead eggs, and Dpys. The Dpys should give all dead embryos at all temperatures. Approximately 60% of these dead embryos make excess mesoderm at the expense of endoderm, due to an E to MS fate transformation. Embryonic lethality is 100% penetrant for or10.

ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 15C. Fast-acting temperature-sensitive allele. At restrictive temperature (26C), animals give rise to 100% dead embryos. At 15C, animals give rise to viable progeny. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. Might still carry unc-119(ed3) III in background. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous tac-1 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous zyg-9 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

Heterozygous. Pick Unc to maintain. Heterozygotes are Unc and segregate Unc heterozygotes, wildtype (or2015 homozygotes that give only dead progeny), and and arrested nT1 aneuploids. Pick Unc and check for correct segregation of progeny to maintain. or2015 is a CRISPR/Cas9-engineered null allele removing the entire apx-1 open reading frame. Reference: Chuang CH, et al. G3 (Bethesda). 2025 Sep 26:jkaf229. doi: 10.1093/g3journal/jkaf229. PMID: 41004705.

Heterozygotes are Unc and lay 10/16 dead embryos. spn-4 homozygotes look WT but are non-conditional maternal effect embryonic lethals. Embryos from homozygous mothers exhibit defects in mitotic spindle orientation and cell fate patterning.

Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs which give only dead eggs at all temperatures. Throws males.

Temperature sensitive. Viable at 15C; lethal at 25C. At 25C, embryos exhibit defects in spindle orientation and cell fate patterning. Throws males.

Temperature sensitive maternal effect lethal mutation in F11H8.1 (Nedd8 activating enzyme). Permissive temperature is 15C, restrictive temperature is 25C. Embryos layed at restrictive temperature have spindle-orientation defects due to the mis-localization of MEI-1/MEI-2 to the mitotic spindle. Additionally, ectopic cleavage furrows are initiated during cytokinesis, and cell-cycle delays are apparent during interphase.

Heterozygotes are WT and lay 10/16 dead eggs. spn-4 unc-42 homozygotes are Unc and lay dead embryos exhibiting defects in mitotic spindle orientation and cell fate patterning. spn-4(or25) homozygotes are non-conditional maternal effect embryonic lethal.

Heterozygotes are Unc and lay 10/16 dead embryos. spn-4 homozygotes look WT but are non-conditional maternal effect embryonic lethals. Embryos from homozygous mothers exhibit defects in mitotic spindle orientation and cell fate patterning.

Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.

Conditional, semi-dominant, maternal-effect, embryonic-lethal mutation. Once-cell stage mitotic embryos have short astral microtubules and a mispositioned mitotic spindle. Maintain at 15C.

Temperature sensitive spn-1. Maintain at 15C. Lethal at 25C. Heterozygotes are WT and segregate WT, Lon which give only dead eggs at all temperatures, and Sterile Dpys(ts).

Temperature sensitive. Viable at 15C; lethal at 25C. At 25C, embryos exhibit defects in spindle orientation and cell fate patterning.