More Fields
Strain Species Genotype
VC2366 C. elegans unc-22(gk1237gk1238) IV. Show Description
Unc-22 twitcher. The gk1237 lesion is a point mutation (C to A) with flanks TTCCATATGGATTGGACACCTCGACTGTGT and CTCTCCAGCATCAATGTCCCAAACTTCCTT. The gk1238 lesion is a 122-bp deletion with flanks CTCCATCACTTGCTTCGAATCTATATCTGC and ACGATTTGTGGGCGACTTCCACCGGATTCC, and a single inserted base (C) at the break. Primers to amplify the region are: cggatgcttggaacaaagtt and tgctcgtgtcactggacttc. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk1237gk1238), it is homozygous for 90 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
VC2452 C. elegans unc-22(gk2608gk2609) IV. Show Description
Unc-22 twitcher. This strain was isolated after ENU mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk2608gk2609), it is homozygous for 224 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
BC177 C. elegans unc-22(s17) IV. Show Description
Twitcher. Both heterozygotes and homozygotes twitch in 1% nicotine.
BC18 C. elegans unc-22(s13) IV. Show Description
Twitcher Unc. Heterozygotes twitch in 1% Nicotine. Recessive.
BC200 C. elegans unc-22(s12) IV. Show Description
Twitcher Unc. Recessive. Heterozygotes twitch in 1% Nicotine.
BC21 C. elegans unc-22(s8) IV. Show Description
Twitcher Unc. Recessive. Heterozygotes twitch in 1% Nicotine.
BC23 C. elegans unc-22(s7) IV. Show Description
Twitcher Unc. Recessive. Heterozygotes twitch in 1% Nicotine
BC96 C. elegans unc-22(s16) IV. Show Description
Twitcher Unc. Recessive. Heterozygotes twitch in 1% Nicotine.
BW1161 C. elegans unc-22(ct169) IV. Show Description
Twitcher.
BW1163 C. elegans unc-22(ct171) IV. Show Description
Twitcher.
BW1166 C. elegans unc-22(ct174) IV. Show Description
Twitcher.
BW1168 C. elegans unc-22(ct176) IV. Show Description
Twitcher.
BW1169 C. elegans unc-22(ct177) IV. Show Description
Twitcher.
BW1176 C. elegans unc-22(ct181) IV. Show Description
CB105 C. elegans unc-22(e105) IV. Show Description
Mild Twitcher Unc.
CB1179 C. elegans unc-22(e1179) IV. Show Description
Twitcher Unc.
CB66 C. elegans unc-22(e66) IV. Show Description
Twitcher.
DR52 C. elegans unc-22(m52) IV. Show Description
Unc-Twitcher. Dominant. Genotype questionable.
DR54 C. elegans unc-22(m54) IV. Show Description
Strong Twitcher. Recessive.
NL3643 C. elegans unc-22(st136) IV. Show Description
Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc.
RW5020 C. elegans unc-22(s32) IV. Show Description
VC1923 C. elegans unc-22(gk3071) IV. Show Description
unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3071), it is homozygous for 323 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
VC1924 C. elegans unc-22(gk965) IV. Show Description
Unc-22 twitcher. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk965), it is homozygous for 546 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
VC2362 C. elegans unc-22(gk3072) IV. Show Description
Unc-22 twitcher. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3072), it is homozygous for 65 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
VC2451 C. elegans unc-22(gk2406) IV. Show Description
Unc-22 twitcher. This strain was isolated after ENU mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk2406), it is homozygous for 206 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
VC3083 C. elegans unc-22(gk3076) IV. Show Description
Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
BA836 C. elegans spe-26(it112) unc-22(e66) IV. Show Description
Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.
BA839 C. elegans spe-26(it118) unc-22(e66) IV. Show Description
Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.
BA966 C. elegans spe-27(it132) unc-22(e66) IV. Show Description
Temperature sensitive spe-27 allele. Hermaphrodites sterile at 25C; hermaphrodites produce 30-40 progeny/hermaphrodite at 16C. Males cannot mate due to the unc-22 mutation. Maintain at 15C.
BC331 C. elegans let-54(s44) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal early larval (L1-L2). Pick heterozygotes to maintain by picking Twitchers in 1% nicotine.
BC917 C. elegans let-61(s65) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal late larval. Maintain by picking WT which throw Lethal Twitchers. Hets twitch in 1% Nicotine.
BC918 C. elegans let-63(s170) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal mid larval. Maintain by picking WT which throw Lethal Twitchers. Hets twitch in 1% Nicotine.
BC933 C. elegans unc-22(s7) let-66(s176)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal early larval. Heterozygotes twitch in 1% nicotine.
BC934 C. elegans let-59(s175) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and dead eggs. Hets twitch in 1% nicotine. Maintain by picking Twitchers in 1% Nicotine.
BC954 C. elegans let-64(s216) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT (twitch in 1% nicotine) and segregate WT and thin, twitcher sterile adults. Pick twitchers in 1% nicotine to maintain.
BC962 C. elegans mars-1(s254) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal mid-larval. Heterozygotes twitch in 1% Nicotine. Maintain by picking Twitchers in 1% Nicotine.
BC987 C. elegans unc-22(s7) let-52(s42)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal early larval. Hets twitch in 1% Nicotine. Pick WT to maintain.
DR185 C. elegans dpy-13(e184) unc-22(m52) IV. Show Description
Dominant Twitcher Unc. Semi-dominant Dpy.
DR245 C. elegans daf-14(m77) unc-22(m52) IV. Show Description
Temperature sensitive dauer constitutive. Dominant Twitcher
KK255 C. elegans dpy-20(e1282) unc-22(e66) IV. Show Description
Dpy. Twitcher.
RW7096 C. elegans mut-6(st702) unc-22(st192) IV. Show Description
Twitcher.
SX157 C. elegans prg-1(n4357) I; unc-22(st136) IV. Show Description
Transposon silencing normal.
SX158 C. elegans prg-1(n4357) I; unc-22(r750) IV. Show Description
Twitching due to transposon insertion in unc-22. [(07/16/2018) NOTE: A user has reported their PCR and sequence analysis suggest this strain contains does not still contain Tc3, but retains loss unc-22 function, apparently due to imprecise excision.]
SX178 C. elegans prg-1(n4357) I; unc-22(r765) IV. Show Description
Twitching due to transposon insertion in unc-22.
BC1548 C. elegans unc-22(s7) let-67(s214)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and Twitcher Steriles. The sterility can be rescued by male sperm.
BC2895 C. elegans let-73(s685) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Twitcher Steriles and dead eggs. Maintain by picking WT.
BC2897 C. elegans let-72(s695) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, dead eggs, and UncLets. Lethal mid-larval. Maintain by picking WT.
BC2898 C. elegans let-71(s692) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vuls and Lethal Twitchers (Late larval lethals). Maintain by picking WT.
BC2903 C. elegans let-92(s504) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, dead eggs and UncLets. Lethal early larval. Maintain by picking WT.
BC2907 C. elegans let-91(s678) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, mid-larval lethals that Twitch, Vuls and dead eggs.