WT strain which segregates WT, Dpy and DpySteriles (or WT Steriles if grown at 15C.) Maintain by picking WT. dpy-27 animals are mildly Dpy and Egl with protruding vulva. Maternal effect: progeny of dpy-27 homozygotes will be severely Dpy, marginally viable, and their progeny will be more severe Dpy hermaphrodites and WT males. Males are vigorous and mate well. See also WBPaper00002061.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Previously called sns-10(oy56).

sEx11817 [rCes Y56A3A.19::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx13243 [rCes Y56A3A.18::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14493 [rCes Y56A3A.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15201[rCesY56A3A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

raEx278 [T05G5.1p::Y56A3A.32(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

Y56A3A.17. Homozygous. Outer Left Sequence: CACTGAAACAGTGCGGAGAG. Outer Right Sequence: AGACGCTGAAAGAGGTTCCA. Inner Left Sequence: TGACTCATCGAGCCTGAAAA. Inner Right Sequence: GAGTCGAACTTCCCAAGCAG. Inner Primer PCR Length: 2218 bp. Deletion Size: 1120 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y56A3A.3. Homozygous. Outer Left Sequence: CCATGTCAACAAAGTCCGTG. Outer Right Sequence: GAATGAAAAATCCAAGGCGA. Inner Left Sequence: CGGTAAATTTCCCCGATTTT. Inner Right Sequence: TTCGTTGGATTTTTCCTTCG. Inner Primer PCR Length: 2533 bp. Deletion Size: 1020 bp. Deletion left flank: AGGCCCCACAGAAAGGAGGCCCCACCACGG. Deletion right flank: CTTTAAACCTATGTGCACTACCAGATAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y56A3A.13 Homozygous. Outer Left Sequence: cgacttgagctacgtggaca. Outer Right Sequence: catcgcatctcttgtagcca. Inner Left Sequence: tcttcgtgaaatgcaaccag. Inner Right Sequence: tgcgaaattttgggattttg. Inner Primer PCR Length: 1134. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y56A3A.29 Homozygous. Outer Left Sequence: aatcgtctctggctctctgg. Outer Right Sequence: cggtttgcctgcaaataact. Inner Left Sequence: gagcaaacccctgaattttt. Inner Right Sequence: cgaataatttcccatttttgtga. Inner Primer PCR Length: 1166. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Homozygous larval arrest. Deletion of 682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve725 homozygotes), Unc-36 non-GFP mKate+ animals (eT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcgcgtcgagacccctaaatctgtgcgcct ; Right flanking sequence: tcgggaaatgactcatcgagcctgaaaaat. sgRNA #1: ttctgatatacttttctcaa; sgRNA #2: aaaaaatttgacgggaaatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

CRISPR/Cas9 engineered tagged endogenous locus.

CRISPR/Cas9 engineered tagged endogenous locus.

Unc. Throws Unc, UncLon males and dead eggs.

Pristionchus pacificus. Ppa-unc-119(y566). Reference: Lo TW, et al. Genetics. 2013 Oct;195(2):331-48.

Unc. Throws Unc, UncLon males and dead eggs.

Temperature-sensitive. Maintain at 15C. Complements other sdc-2 alleles at 15C. At 20C animals are not Dpy or Tra, but there is a low penetrance of lethality, some Egl animals, and some animals will Bag after a couple days of egg-laying. y93 fails to complement other sdc-2 alleles at 25C; homozygotes are Egl,Tra and weakly Dpy at higher temperatures. Shifting embryos (prepared from non-Dpy non-Egl non-Tra gravid adults at 20C) from 20C to 25C is sufficient to alter their phenotype. Reference: Nusbaum C & Meyer BJ. Genetics. 1989 Jul;122(3):579-93.

Y56A3A.33. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y56A3A.20. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk40 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y56A3A.3. External left primer: TAAAGCACAAATCCCGGAAG. External right primer: GTTTGACCGTTGTAGGCGAT. Internal left primer: ATGTGCAGCAGAAAGGGAAG. Internal right primer: TTGTCGAATCACACAGGAGG. Internal WT amplicon: 2124 bp. Deletion size: 1620 bp. Deletion left flank: AAAAAAGAGGACGAAAAAAAAGTTTTGAAT. Deletion right flank: AGTAAAAGAATGATGAATTTCTTTTCCGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y56A3A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2738 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTAAGCTCCGCCCATTTCT. External right primer: AACATCAATTTTGCCGGAAG. Internal left primer: GCTATTTCGCACTAAAATTGTTCA. Internal right primer: GAAGTTTCAATTCCGGCAAA. Internal WT amplicon: 1156 bp. Deletion size: 411 bp. Deletion left flank: ACGTTCGAATACACCTCCACCAGTCGGCAA. Deletion right flank: GTGCCAGAATTTGAATTTCCGGCAAATCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

2A::H1::mCherry was inserted at the 3' end of the endogenous Y56A3A.18 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.