More Fields
Strain Species Genotype
DR1410 C. elegans dpy-27(y56)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
WT strain which segregates WT, Dpy and DpySteriles (or WT Steriles if grown at 15C.) Maintain by picking WT. dpy-27 animals are mildly Dpy and Egl with protruding vulva. Maternal effect: dpy-27 homozygotes from het parent give severe Dpy hermaphrodites which are marginally viable and give more severe Dpy hermaphrodites and WT males. Males are vigorous and mate well. See also WBPaper00002061.
NK2502 C. elegans ten-1(qy56[ten-1::mNG+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
PY3019 C. elegans alr-1(oy56) X. Show Description
Previously called sns-10(oy56).
BC11817 C. elegans dpy-5(e907) I; sEx11817. Show Description
sEx11817 [rCes Y56A3A.19::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC13243 C. elegans dpy-5(e907) I; sEx13243. Show Description
sEx13243 [rCes Y56A3A.18::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14493 C. elegans dpy-5(e907) I; sEx14493. Show Description
sEx14493 [rCes Y56A3A.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15201 C. elegans dpy-5(e907) I; sEx15201. Show Description
sEx15201[rCesY56A3A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
DM7278 C. elegans pha-1(e2123) III; raEx278. Show Description
raEx278 [Y56A3A.32::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
RB1534 C. elegans npp-16(ok1839) III. Show Description
Y56A3A.17. Homozygous. Outer Left Sequence: CACTGAAACAGTGCGGAGAG. Outer Right Sequence: AGACGCTGAAAGAGGTTCCA. Inner Left Sequence: TGACTCATCGAGCCTGAAAA. Inner Right Sequence: GAGTCGAACTTCCCAAGCAG. Inner Primer PCR Length: 2218 bp. Deletion Size: 1120 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1633 C. elegans mif-1(ok2009) III. Show Description
Y56A3A.3. Homozygous. Outer Left Sequence: CCATGTCAACAAAGTCCGTG. Outer Right Sequence: GAATGAAAAATCCAAGGCGA. Inner Left Sequence: CGGTAAATTTCCCCGATTTT. Inner Right Sequence: TTCGTTGGATTTTTCCTTCG. Inner Primer PCR Length: 2533 bp. Deletion Size: 1020 bp. Deletion left flank: AGGCCCCACAGAAAGGAGGCCCCACCACGG. Deletion right flank: CTTTAAACCTATGTGCACTACCAGATAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2577 C. elegans nft-1(ok3589) III. Show Description
Y56A3A.13 Homozygous. Outer Left Sequence: cgacttgagctacgtggaca. Outer Right Sequence: catcgcatctcttgtagcca. Inner Left Sequence: tcttcgtgaaatgcaaccag. Inner Right Sequence: tgcgaaattttgggattttg. Inner Primer PCR Length: 1134. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2581 C. elegans Y56A3A.29(ok3593) III. Show Description
Y56A3A.29 Homozygous. Outer Left Sequence: aatcgtctctggctctctgg. Outer Right Sequence: cggtttgcctgcaaataact. Inner Left Sequence: gagcaaacccctgaattttt. Inner Right Sequence: cgaataatttcccatttttgtga. Inner Primer PCR Length: 1166. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3225 C. elegans Y56A3A.19(ve725[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/eT1 III; +/eT1 [umnIs46] V. Show Description
umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Homozygous larval arrest. Deletion of 682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve725 homozygotes), Unc-36 non-GFP mKate+ animals (eT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcgcgtcgagacccctaaatctgtgcgcct ; Right flanking sequence: tcgggaaatgactcatcgagcctgaaaaat. sgRNA #1: ttctgatatacttttctcaa; sgRNA #2: aaaaaatttgacgggaaatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW12265 C. elegans Y56A3A.18(st12265[Y56A3A.18::TY1::EGFP::3xFLAG]) III. Show Description
CRISPR/Cas9 engineered tagged endogneous locus.
TY562 C. elegans +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf3/szT1 X. Show Description
Unc. Throws Unc, UncLon males and dead eggs.
TY5640 Pristionchus pacificus Ppa-unc-119(y566). Show Description
Pristionchus pacificus. Ppa-unc-119(y566). Reference: Lo TW, et al. Genetics. 2013 Oct;195(2):331-48.
TY567 C. elegans +/szT1 [lon-2(e678)] I; unc-32(e189) III; yDf2/szT1 X. Show Description
Unc. Throws Unc, UncLon males and dead eggs.
TY5684 C. elegans sdc-2(y93) X. Show Description
Temperature-sensitive. Maintain at 15C. Complements other sdc-2 alleles at 15C. At 20C animals are not Dpy or Tra, but there is a low penetrance of lethality, some Egl animals, and some animals will Bag after a couple days of egg-laying. y93 fails to complement other sdc-2 alleles at 25C; homozygotes are Egl,Tra and weakly Dpy at higher temperatures. Shifting embryos (prepared from non-Dpy non-Egl non-Tra gravid adults at 20C) from 20C to 25C is sufficient to alter their phenotype. Reference: Nusbaum C & Meyer BJ. Genetics. 1989 Jul;122(3):579-93.
VC1077 C. elegans Y56A3A.33(ok1544) III. Show Description
Y56A3A.33. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC112 C. elegans ccf-1(gk40)/eT1 III; +/eT1 IV. Show Description
Y56A3A.20. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk40 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1701 C. elegans mif-1(gk1027) III. Show Description
Y56A3A.3. External left primer: TAAAGCACAAATCCCGGAAG. External right primer: GTTTGACCGTTGTAGGCGAT. Internal left primer: ATGTGCAGCAGAAAGGGAAG. Internal right primer: TTGTCGAATCACACAGGAGG. Internal WT amplicon: 2124 bp. Deletion size: 1620 bp. Deletion left flank: AAAAAAGAGGACGAAAAAAAAGTTTTGAAT. Deletion right flank: AGTAAAAGAATGATGAATTTCTTTTCCGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2100 C. elegans Y56A3A.2(ok2738) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y56A3A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2738 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTAAGCTCCGCCCATTTCT. External right primer: AACATCAATTTTGCCGGAAG. Internal left primer: GCTATTTCGCACTAAAATTGTTCA. Internal right primer: GAAGTTTCAATTCCGGCAAA. Internal WT amplicon: 1156 bp. Deletion size: 411 bp. Deletion left flank: ACGTTCGAATACACCTCCACCAGTCGGCAA. Deletion right flank: GTGCCAGAATTTGAATTTCCGGCAAATCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807